Incidental Mutation 'R4332:Rbm12b1'
ID323618
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene NameRNA binding motif protein 12 B1
Synonyms
MMRRC Submission 041099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4332 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location12140264-12146731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12145655 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 542 (K542N)
Ref Sequence ENSEMBL: ENSMUSP00000064195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
Predicted Effect probably benign
Transcript: ENSMUST00000050069
AA Change: K542N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: K542N

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069128
AA Change: K542N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: K542N

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146416
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 105,709,724 I175T possibly damaging Het
A2m A G 6: 121,657,447 D646G probably benign Het
Acat2 T C 17: 12,962,895 probably benign Het
Armc10 T A 5: 21,661,581 V281E probably damaging Het
Best3 T A 10: 117,002,524 F162L probably benign Het
Ccdc129 G A 6: 55,968,235 G647D possibly damaging Het
Ces1g T C 8: 93,319,818 M360V probably benign Het
Chd7 G T 4: 8,854,143 R1905L probably damaging Het
Dhx36 C T 3: 62,484,991 R538Q probably damaging Het
Efna2 G A 10: 80,188,481 R161Q probably damaging Het
Farsb T C 1: 78,469,266 T159A possibly damaging Het
Fry C T 5: 150,381,663 A611V probably damaging Het
Fsip2 A G 2: 82,977,857 T1507A probably benign Het
Gm11492 T G 11: 87,567,904 L368R possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Gm7367 T C 7: 60,155,616 noncoding transcript Het
Gm9312 A T 12: 24,252,094 noncoding transcript Het
Gmfg A T 7: 28,437,572 M1L probably benign Het
Gpr149 C A 3: 62,604,373 L68F possibly damaging Het
Hmga2 T C 10: 120,364,212 probably benign Het
Il12a C A 3: 68,695,261 probably benign Het
Itsn2 T A 12: 4,712,611 M1597K possibly damaging Het
Kyat3 A G 3: 142,725,426 I154M probably damaging Het
Npas3 A C 12: 54,062,069 I419L probably damaging Het
Ogfrl1 T A 1: 23,375,829 Y199F probably damaging Het
Olfr259 A G 2: 87,107,745 V214A possibly damaging Het
Olfr305 A C 7: 86,363,872 V155G probably benign Het
Olfr711 T C 7: 106,972,147 M66V probably benign Het
P2rx3 G A 2: 85,024,861 P84S probably benign Het
P3h3 A G 6: 124,842,136 V657A probably damaging Het
Pabpc2 A G 18: 39,775,340 M553V probably benign Het
Pcdhb1 T C 18: 37,265,530 F178S probably damaging Het
Plppr4 A T 3: 117,322,825 M403K probably benign Het
Ralgapa2 G A 2: 146,260,368 T1956M probably benign Het
Rdh8 C T 9: 20,822,629 A37V probably damaging Het
Rnf213 A G 11: 119,436,676 T1830A probably damaging Het
Sardh G T 2: 27,215,114 Q666K possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb11 G A 1: 107,369,564 probably null Het
Slc6a6 G A 6: 91,723,471 G60D probably damaging Het
Tfr2 A G 5: 137,571,734 D134G probably damaging Het
Tmprss15 T C 16: 79,034,334 T378A probably benign Het
Tmprss7 T G 16: 45,686,327 K124T probably benign Het
Urb1 A G 16: 90,774,537 L1128P probably damaging Het
Usp32 C T 11: 85,103,978 C36Y possibly damaging Het
Vmn2r50 T A 7: 10,052,995 T62S probably benign Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
PIT4618001:Rbm12b1 UTSW 4 12145441 missense probably damaging 1.00
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12145491 missense probably benign 0.04
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12146431 missense probably benign 0.00
R7740:Rbm12b1 UTSW 4 12145954 missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12146460 missense possibly damaging 0.92
R8083:Rbm12b1 UTSW 4 12146409 missense probably damaging 1.00
R8129:Rbm12b1 UTSW 4 12145549 missense probably damaging 1.00
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAGTTTGGTGTAAAGTCTTCC -3'
(R):5'- TGAGATGGCCGTCTGAAGTC -3'

Sequencing Primer
(F):5'- CCTGGTTGTCTAATGAGAGGACAC -3'
(R):5'- AAGGGCTTCTTAGCTGCCTACG -3'
Posted On2015-06-24