Mutagenetix > Incidental Mutation

Incidental Mutation 'R4332:Sardh'

323606

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

041099-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R4332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 27215114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 666 (Q666K)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000091224

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102886
AA Change: Q666K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: Q666K

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170435

Meta Mutation Damage Score

0.1830

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	C	8: 105,709,724	I175T	possibly damaging	Het
A2m	A	G	6: 121,657,447	D646G	probably benign	Het
Acat2	T	C	17: 12,962,895		probably benign	Het
Armc10	T	A	5: 21,661,581	V281E	probably damaging	Het
Best3	T	A	10: 117,002,524	F162L	probably benign	Het
Ccdc129	G	A	6: 55,968,235	G647D	possibly damaging	Het
Ces1g	T	C	8: 93,319,818	M360V	probably benign	Het
Chd7	G	T	4: 8,854,143	R1905L	probably damaging	Het
Dhx36	C	T	3: 62,484,991	R538Q	probably damaging	Het
Efna2	G	A	10: 80,188,481	R161Q	probably damaging	Het
Farsb	T	C	1: 78,469,266	T159A	possibly damaging	Het
Fry	C	T	5: 150,381,663	A611V	probably damaging	Het
Fsip2	A	G	2: 82,977,857	T1507A	probably benign	Het
Gm11492	T	G	11: 87,567,904	L368R	possibly damaging	Het
Gm5592	G	T	7: 41,216,118		probably benign	Het
Gm7367	T	C	7: 60,155,616		noncoding transcript	Het
Gm9312	A	T	12: 24,252,094		noncoding transcript	Het
Gmfg	A	T	7: 28,437,572	M1L	probably benign	Het
Gpr149	C	A	3: 62,604,373	L68F	possibly damaging	Het
Hmga2	T	C	10: 120,364,212		probably benign	Het
Il12a	C	A	3: 68,695,261		probably benign	Het
Itsn2	T	A	12: 4,712,611	M1597K	possibly damaging	Het
Kyat3	A	G	3: 142,725,426	I154M	probably damaging	Het
Npas3	A	C	12: 54,062,069	I419L	probably damaging	Het
Ogfrl1	T	A	1: 23,375,829	Y199F	probably damaging	Het
Olfr259	A	G	2: 87,107,745	V214A	possibly damaging	Het
Olfr305	A	C	7: 86,363,872	V155G	probably benign	Het
Olfr711	T	C	7: 106,972,147	M66V	probably benign	Het
P2rx3	G	A	2: 85,024,861	P84S	probably benign	Het
P3h3	A	G	6: 124,842,136	V657A	probably damaging	Het
Pabpc2	A	G	18: 39,775,340	M553V	probably benign	Het
Pcdhb1	T	C	18: 37,265,530	F178S	probably damaging	Het
Plppr4	A	T	3: 117,322,825	M403K	probably benign	Het
Ralgapa2	G	A	2: 146,260,368	T1956M	probably benign	Het
Rbm12b1	G	T	4: 12,145,655	K542N	probably benign	Het
Rdh8	C	T	9: 20,822,629	A37V	probably damaging	Het
Rnf213	A	G	11: 119,436,676	T1830A	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Serpinb11	G	A	1: 107,369,564		probably null	Het
Slc6a6	G	A	6: 91,723,471	G60D	probably damaging	Het
Tfr2	A	G	5: 137,571,734	D134G	probably damaging	Het
Tmprss15	T	C	16: 79,034,334	T378A	probably benign	Het
Tmprss7	T	G	16: 45,686,327	K124T	probably benign	Het
Urb1	A	G	16: 90,774,537	L1128P	probably damaging	Het
Usp32	C	T	11: 85,103,978	C36Y	possibly damaging	Het
Vmn2r50	T	A	7: 10,052,995	T62S	probably benign	Het
Zfp110	T	A	7: 12,844,571	Y136*	probably null	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1514:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGAGGAGTGGTTATGCC -3'
(R):5'- GGCACCAGAGTTTTAACCATTTG -3'

Sequencing Primer
(F):5'- AGTGGTTATGCCCATGAGC -3'
(R):5'- AAGAGGCCCTTGATATTGCTC -3'

Posted On

2015-06-24