Incidental Mutation 'R4307:Kif27'
ID324069
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 041658-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58344123 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 401 (V401I)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: V401I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: V401I

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: V401I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R1961:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58345748 missense probably benign 0.01
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4736:Kif27 UTSW 13 58328971 missense probably benign 0.04
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58293143 missense probably damaging 0.98
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R5929:Kif27 UTSW 13 58343970 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
R7480:Kif27 UTSW 13 58288211 missense probably benign 0.34
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGCTGGGGTCCTTCTTC -3'
(R):5'- GCACGGAATATTAGAAACAAACCTG -3'

Sequencing Primer
(F):5'- AGGTTCCCAATGCCCTGG -3'
(R):5'- TGCTTTAAACATAAGTCCCCAGG -3'
Posted On2015-06-24