Incidental Mutation 'R4168:Kif27'
ID320669
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 041009-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58345748 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 127 (I127T)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: I127T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: I127T

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: I127T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R1961:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4307:Kif27 UTSW 13 58344123 missense probably benign 0.00
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4736:Kif27 UTSW 13 58328971 missense probably benign 0.04
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58293143 missense probably damaging 0.98
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R5929:Kif27 UTSW 13 58343970 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
R7480:Kif27 UTSW 13 58288211 missense probably benign 0.34
R8381:Kif27 UTSW 13 58291177 missense probably benign 0.00
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGGCATCCTGACAGGTC -3'
(R):5'- GTCCATTACAGAATCATCCATGGTTAC -3'

Sequencing Primer
(F):5'- AGGTCCCTGGGTCTTACCAAG -3'
(R):5'- ATCCGTAACGAGATCTGGCG -3'
Posted On2015-06-12