Incidental Mutation 'R4389:Nptn'
ID326336
Institutional Source Beutler Lab
Gene Symbol Nptn
Ensembl Gene ENSMUSG00000032336
Gene Nameneuroplastin
SynonymsSdfr1
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58582240-58657955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58643772 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 361 (K361E)
Ref Sequence ENSEMBL: ENSMUSP00000135199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085651] [ENSMUST00000114121] [ENSMUST00000175945] [ENSMUST00000176250] [ENSMUST00000176557] [ENSMUST00000176916] [ENSMUST00000177064] [ENSMUST00000177292] [ENSMUST00000177380]
Predicted Effect probably damaging
Transcript: ENSMUST00000085651
AA Change: K245E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082793
Gene: ENSMUSG00000032336
AA Change: K245E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 1.1e-3 SMART
IGc2 133 206 9.3e-7 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114121
AA Change: K245E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109756
Gene: ENSMUSG00000032336
AA Change: K245E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175945
SMART Domains Protein: ENSMUSP00000135576
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176126
Predicted Effect probably damaging
Transcript: ENSMUST00000176250
AA Change: K135E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135250
Gene: ENSMUSG00000032336
AA Change: K135E

DomainStartEndE-ValueType
IGc2 23 96 2.34e-4 SMART
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176557
AA Change: K245E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135541
Gene: ENSMUSG00000032336
AA Change: K245E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176896
SMART Domains Protein: ENSMUSP00000134761
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 37 117 2.56e-1 SMART
IGc2 132 205 2.34e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176916
AA Change: K135E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134977
Gene: ENSMUSG00000032336
AA Change: K135E

DomainStartEndE-ValueType
IGc2 23 96 2.34e-4 SMART
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177064
AA Change: K157E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135316
Gene: ENSMUSG00000032336
AA Change: K157E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 45 118 2.34e-4 SMART
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177292
AA Change: K361E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135199
Gene: ENSMUSG00000032336
AA Change: K361E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 43 123 4.09e-9 SMART
IG 154 234 2.56e-1 SMART
IGc2 249 322 2.34e-4 SMART
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177380
SMART Domains Protein: ENSMUSP00000135886
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
Meta Mutation Damage Score 0.8534 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic spine morphology, decreased CNS synapse formation, abnormal CNS synaptic transmission and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Nptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Nptn APN 9 58643639 missense probably damaging 1.00
IGL02043:Nptn APN 9 58640729 missense possibly damaging 0.56
kinda_slow UTSW 9 58623752 missense probably damaging 1.00
R0212:Nptn UTSW 9 58627881 missense probably benign 0.03
R1585:Nptn UTSW 9 58640790 missense probably benign 0.17
R1673:Nptn UTSW 9 58623732 missense probably benign 0.12
R2484:Nptn UTSW 9 58643673 missense possibly damaging 0.85
R4151:Nptn UTSW 9 58643542 missense probably benign 0.14
R4721:Nptn UTSW 9 58640776 missense probably damaging 1.00
R5166:Nptn UTSW 9 58618980 nonsense probably null
R5346:Nptn UTSW 9 58623787 nonsense probably null
R6494:Nptn UTSW 9 58623752 missense probably damaging 1.00
R6520:Nptn UTSW 9 58643734 missense probably damaging 1.00
R7506:Nptn UTSW 9 58618873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAATCACAGAAGATCCTGG -3'
(R):5'- AGGCCTAGGGTTTGGAGAAC -3'

Sequencing Primer
(F):5'- TCCTGGAGAGTATGAATGTAATGCC -3'
(R):5'- ACGAGTCCTTACATTCCTC -3'
Posted On2015-07-06