Incidental Mutation 'R0045:Olfr703'
ID32764
Institutional Source Beutler Lab
Gene Symbol Olfr703
Ensembl Gene ENSMUSG00000073901
Gene Nameolfactory receptor 703
SynonymsMOR283-7, GA_x6K02T2PBJ9-9222217-9223176
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0045 (G1)
Quality Score110
Status Validated
Chromosome7
Chromosomal Location106843360-106846207 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106845389 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 259 (Y259*)
Ref Sequence ENSEMBL: ENSMUSP00000149022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098142] [ENSMUST00000216254]
Predicted Effect probably null
Transcript: ENSMUST00000098142
AA Change: Y259*
SMART Domains Protein: ENSMUSP00000095746
Gene: ENSMUSG00000073901
AA Change: Y259*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.4e-8 PFAM
Pfam:7tm_1 41 290 1.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216254
AA Change: Y259*
Meta Mutation Damage Score 0.9661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Olfr703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr703 APN 7 106845367 missense possibly damaging 0.78
IGL01321:Olfr703 APN 7 106844749 missense probably damaging 1.00
IGL02169:Olfr703 APN 7 106845266 nonsense probably null
IGL03376:Olfr703 APN 7 106845470 missense probably damaging 1.00
R0662:Olfr703 UTSW 7 106844649 missense probably benign 0.01
R1589:Olfr703 UTSW 7 106845196 missense possibly damaging 0.57
R1869:Olfr703 UTSW 7 106845094 missense probably benign 0.01
R2431:Olfr703 UTSW 7 106845391 missense possibly damaging 0.95
R4021:Olfr703 UTSW 7 106845019 missense probably damaging 1.00
R5280:Olfr703 UTSW 7 106844695 missense probably benign 0.01
R6352:Olfr703 UTSW 7 106845222 missense probably damaging 1.00
R6932:Olfr703 UTSW 7 106844802 nonsense probably null
R7037:Olfr703 UTSW 7 106845336 missense probably damaging 1.00
R7909:Olfr703 UTSW 7 106844992 missense probably benign 0.29
R7990:Olfr703 UTSW 7 106844992 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAAGCTGGCCTGTGAAGATACATCC -3'
(R):5'- TCTGACACCAGACCTGAATCTCCTC -3'

Sequencing Primer
(F):5'- ACATCCACATACGAGTTGATGG -3'
(R):5'- TAGCTGAGATAATTGCCCAGAC -3'
Posted On2013-05-09