Incidental Mutation 'R4445:Olfr694'
ID329838
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission 041151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4445 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106689146 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 195 (Y195F)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052535
AA Change: Y195F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: Y195F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082091
AA Change: Y195F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: Y195F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect possibly damaging
Transcript: ENSMUST00000216118
AA Change: Y195F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216895
AA Change: Y195F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,502,994 V253D probably damaging Het
2410089E03Rik A G 15: 8,252,188 D2837G unknown Het
Adgrg6 A G 10: 14,409,763 S1160P probably damaging Het
Adgrl1 T C 8: 83,934,860 L962P probably damaging Het
Als2cr12 A T 1: 58,666,921 I263K possibly damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Calcoco1 A G 15: 102,715,740 probably null Het
Cd59a A G 2: 104,110,818 Q47R probably benign Het
Cdkl2 G A 5: 92,020,309 T342I probably benign Het
Cfap45 G A 1: 172,535,227 V262M probably benign Het
Chd8 A T 14: 52,204,527 probably null Het
Cntnap2 C T 6: 46,759,851 T737I probably benign Het
Crot T C 5: 8,973,643 H415R probably damaging Het
Cyp17a1 A G 19: 46,668,023 F411L probably damaging Het
Cyp4a12a G A 4: 115,326,783 probably null Het
Cysltr2 G A 14: 73,029,893 H126Y possibly damaging Het
Ddx56 A T 11: 6,265,770 probably null Het
Elmod1 T A 9: 53,934,129 D93V probably damaging Het
Epb41l2 T C 10: 25,443,803 L178P possibly damaging Het
Galnt10 T A 11: 57,783,691 V502D probably damaging Het
Gm11735 T C 11: 116,739,062 noncoding transcript Het
Hist1h4k T C 13: 21,750,343 T55A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Igsf9b A G 9: 27,334,252 T1172A probably benign Het
Ip6k3 A G 17: 27,145,102 I324T probably benign Het
Klkb1 C T 8: 45,277,055 S263N probably benign Het
Lrit3 A T 3: 129,788,531 C602* probably null Het
Lyst T C 13: 13,709,564 S2986P probably benign Het
Mapkapk5 T C 5: 121,525,228 T445A probably benign Het
Mms19 A T 19: 41,963,933 M119K possibly damaging Het
Myo7a T C 7: 98,066,404 D63G probably damaging Het
Nsun2 G A 13: 69,629,721 probably null Het
Olfr356 T G 2: 36,937,551 L144R probably damaging Het
Olfr538 C A 7: 140,574,389 P79T probably damaging Het
Olfr574 T C 7: 102,948,798 L101P possibly damaging Het
Pabpc2 T C 18: 39,774,200 F173L probably damaging Het
Ppil2 A T 16: 17,103,600 Y73* probably null Het
Rngtt A G 4: 33,499,035 I531V probably benign Het
Sacs A G 14: 61,204,686 M1394V probably benign Het
Setd1b G T 5: 123,148,104 E404D unknown Het
Slc25a54 G A 3: 109,098,668 R164H probably benign Het
Slc2a13 A G 15: 91,350,020 V371A possibly damaging Het
Spag9 C G 11: 94,097,253 L798V possibly damaging Het
Tbce A T 13: 13,998,395 S484T possibly damaging Het
Tcf12 C T 9: 71,869,063 R399Q probably damaging Het
Ttn A G 2: 76,784,833 V16847A probably benign Het
Ttn A G 2: 76,856,866 probably benign Het
Vmn1r11 T G 6: 57,137,530 L23V probably benign Het
Vmn2r59 C T 7: 42,042,450 C541Y probably damaging Het
Vmn2r82 A C 10: 79,379,040 T286P possibly damaging Het
Vps13c T G 9: 67,982,495 probably null Het
Wdr60 G A 12: 116,207,715 A967V probably damaging Het
Zdhhc6 T C 19: 55,302,737 I349V probably benign Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7420:Olfr694 UTSW 7 106689020 missense possibly damaging 0.74
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGCTGTGGAAGGAAC -3'
(R):5'- TGAGTCAGAAAGTCTGCTGTC -3'

Sequencing Primer
(F):5'- GGGTAATACATACATGACAATAGCAC -3'
(R):5'- AGTCAGAAAGTCTGCTGTCTCATG -3'
Posted On2015-07-21