Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Olfr694'

326841

Institutional Source

Beutler Lab

Gene Symbol

Olfr694

Ensembl Gene

ENSMUSG00000064223

Gene Name

olfactory receptor 694

Synonyms

MOR283-9, GA_x6K02T2PBJ9-9067220-9066273

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106684980-106691814 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106689011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 240 (T240I)

Ref Sequence

ENSEMBL: ENSMUSP00000151027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]

AlphaFold

K7N641

Predicted Effect

probably benign
Transcript: ENSMUST00000052535
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: T240I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	4.1e-43	PFAM
Pfam:7tm_1	41	290	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082091
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: T240I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	5.6e-47	PFAM
Pfam:7TM_GPCR_Srsx	35	305	7.6e-6	PFAM
Pfam:7tm_1	41	290	7.1e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208331

Predicted Effect

probably benign
Transcript: ENSMUST00000216118
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000216895
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Olfr694

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01546:Olfr694	APN	7	106689531	missense	probably damaging	1.00
IGL01759:Olfr694	APN	7	106689333	missense	probably benign	0.04
IGL02435:Olfr694	APN	7	106689503	missense	probably benign	0.26
IGL02569:Olfr694	APN	7	106689642	missense	probably benign	0.19
IGL02611:Olfr694	APN	7	106688789	missense	probably benign	0.11
IGL02726:Olfr694	APN	7	106689370	nonsense	probably null
IGL02944:Olfr694	APN	7	106689269	missense	probably damaging	1.00
IGL03155:Olfr694	APN	7	106689239	missense	probably damaging	1.00
R0238:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0238:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0239:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0239:Olfr694	UTSW	7	106689255	missense	probably benign	0.00
R0609:Olfr694	UTSW	7	106688998	missense	probably damaging	1.00
R0655:Olfr694	UTSW	7	106689425	missense	probably damaging	1.00
R1562:Olfr694	UTSW	7	106688980	missense	probably benign	0.01
R1641:Olfr694	UTSW	7	106689711	missense	probably benign	0.36
R2144:Olfr694	UTSW	7	106688957	missense	probably damaging	0.99
R4444:Olfr694	UTSW	7	106689146	missense	possibly damaging	0.60
R4445:Olfr694	UTSW	7	106689146	missense	possibly damaging	0.60
R4567:Olfr694	UTSW	7	106689213	nonsense	probably null
R4739:Olfr694	UTSW	7	106689144	nonsense	probably null
R4778:Olfr694	UTSW	7	106689667	missense	probably damaging	0.97
R4908:Olfr694	UTSW	7	106689533	missense	probably damaging	1.00
R5244:Olfr694	UTSW	7	106689189	missense	probably benign	0.12
R5944:Olfr694	UTSW	7	106689646	nonsense	probably null
R6260:Olfr694	UTSW	7	106688872	missense	probably damaging	1.00
R6573:Olfr694	UTSW	7	106689463	missense	probably benign	0.00
R6901:Olfr694	UTSW	7	106689189	missense	probably benign	0.03
R7230:Olfr694	UTSW	7	106689524	missense	possibly damaging	0.94
R7420:Olfr694	UTSW	7	106689020	missense	possibly damaging	0.74
R7426:Olfr694	UTSW	7	106689210	missense	possibly damaging	0.88
R8400:Olfr694	UTSW	7	106689669	missense	probably benign	0.25
R8879:Olfr694	UTSW	7	106689089	missense	probably damaging	1.00
R9284:Olfr694	UTSW	7	106689209	missense	possibly damaging	0.88
R9304:Olfr694	UTSW	7	106689673	missense	probably benign	0.04
U24488:Olfr694	UTSW	7	106689089	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACCTTTTCCCCAGGACTC -3'
(R):5'- GACACCTCTTCTGTGAGATTCC -3'

Sequencing Primer
(F):5'- AAAGCCCCAGTGACCTCCTTATTC -3'
(R):5'- GTGAGATTCCTCCCTTGCTAAAG -3'

Posted On

2015-07-07