Incidental Mutation 'R4416:Olfr694'
ID326841
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106689011 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 240 (T240I)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect probably benign
Transcript: ENSMUST00000052535
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: T240I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082091
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: T240I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect probably benign
Transcript: ENSMUST00000216118
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216895
AA Change: T240I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7420:Olfr694 UTSW 7 106689020 missense possibly damaging 0.74
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTTTTCCCCAGGACTC -3'
(R):5'- GACACCTCTTCTGTGAGATTCC -3'

Sequencing Primer
(F):5'- AAAGCCCCAGTGACCTCCTTATTC -3'
(R):5'- GTGAGATTCCTCCCTTGCTAAAG -3'
Posted On2015-07-07