Incidental Mutation 'R4459:Olfr112'
ID330077
Institutional Source Beutler Lab
Gene Symbol Olfr112
Ensembl Gene ENSMUSG00000051611
Gene Nameolfactory receptor 112
Synonyms4930580F03Rik, GA_x6K02T2PSCP-2023769-2022807, MOR218-4
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37561668-37569451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37563474 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 279 (T279I)
Ref Sequence ENSEMBL: ENSMUSP00000150904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085548] [ENSMUST00000174798] [ENSMUST00000208832] [ENSMUST00000213274]
Predicted Effect probably damaging
Transcript: ENSMUST00000085548
AA Change: T279I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082684
Gene: ENSMUSG00000051611
AA Change: T279I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.3e-7 PFAM
Pfam:7tm_1 41 290 8.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173676
Predicted Effect probably damaging
Transcript: ENSMUST00000174798
AA Change: T279I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133654
Gene: ENSMUSG00000051611
AA Change: T279I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 296 3.2e-7 PFAM
Pfam:7tm_1 41 290 8.2e-30 PFAM
Pfam:7tm_4 139 283 1.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208832
AA Change: T279I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213274
AA Change: T279I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighg2b T C 12: 113,306,958 Y184C unknown Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Olfr112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Olfr112 APN 17 37563580 missense possibly damaging 0.94
IGL02900:Olfr112 APN 17 37563849 missense possibly damaging 0.72
IGL03352:Olfr112 APN 17 37563790 missense probably damaging 1.00
R0945:Olfr112 UTSW 17 37563387 missense probably benign 0.00
R2475:Olfr112 UTSW 17 37563711 missense probably benign
R4601:Olfr112 UTSW 17 37564185 missense probably damaging 1.00
R5126:Olfr112 UTSW 17 37563828 missense probably benign 0.22
R6745:Olfr112 UTSW 17 37563579 missense probably damaging 1.00
R7806:Olfr112 UTSW 17 37564221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTGAAGGAATCCCAATGAC -3'
(R):5'- CATGGTTAGTTTCCTGACTGCAG -3'

Sequencing Primer
(F):5'- TCCCAATGACTATAAACATTCTTGTG -3'
(R):5'- ACTGGGATTGTCATCTCCTATG -3'
Posted On2015-07-21