Incidental Mutation 'R4459:Ighg2b'
ID330069
Institutional Source Beutler Lab
Gene Symbol Ighg2b
Ensembl Gene ENSMUSG00000076613
Gene Nameimmunoglobulin heavy constant gamma 2B
SynonymsIgG2b, gamma2b
MMRRC Submission 041579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4459 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113302965-113307933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113306958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 184 (Y184C)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103418
AA Change: Y184C
SMART Domains Protein: ENSMUSP00000100214
Gene: ENSMUSG00000076613
AA Change: Y184C

DomainStartEndE-ValueType
IGc1 22 92 6.9e-16 SMART
low complexity region 108 121 N/A INTRINSIC
IG_like 145 220 4.02e-2 SMART
IGc1 251 324 1.64e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192188
AA Change: Y184C
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,745 L395P probably damaging Het
Abcc4 C T 14: 118,599,393 R652Q probably benign Het
Anks1b G A 10: 90,510,844 V669I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
BC049715 G A 6: 136,840,052 A97T probably damaging Het
Cyp11b1 T A 15: 74,836,359 E422D probably damaging Het
Dmxl1 A T 18: 49,961,216 I2920F possibly damaging Het
Efcab6 C T 15: 83,904,289 G935S probably damaging Het
Esp3 C G 17: 40,633,587 T40S probably null Het
Gc T C 5: 89,441,287 M206V probably benign Het
Gm15446 A T 5: 109,943,241 H453L probably benign Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Itga2 C G 13: 114,843,483 D1061H probably damaging Het
Kcnj5 A G 9: 32,322,395 I208T probably damaging Het
Klhl26 T C 8: 70,451,544 Y538C probably damaging Het
Letm2 A G 8: 25,586,699 C296R probably damaging Het
Lrfn4 C T 19: 4,612,634 V452I probably benign Het
Mypn A G 10: 63,192,432 V284A probably damaging Het
Olfr1110 T C 2: 87,135,661 H220R probably benign Het
Olfr112 G A 17: 37,563,474 T279I probably damaging Het
Olfr1391 A T 11: 49,327,876 N155I probably damaging Het
Olfr898 T A 9: 38,349,992 V297D probably damaging Het
Pcdhgb6 C T 18: 37,742,706 P156S probably benign Het
Pih1d3 A G 1: 31,223,324 D129G probably damaging Het
Pou2f1 A G 1: 165,895,006 F337L probably damaging Het
Prl7a2 A G 13: 27,665,996 V31A probably benign Het
Rasal2 A G 1: 157,175,832 F419S possibly damaging Het
Rmnd5a C T 6: 71,396,881 G310R probably damaging Het
Rrm2b T A 15: 37,945,153 probably null Het
Smg8 T C 11: 87,085,570 D395G probably benign Het
Snx30 A T 4: 59,885,022 R221* probably null Het
Tyk2 T C 9: 21,124,415 E157G probably damaging Het
Wdr90 T A 17: 25,861,002 T120S possibly damaging Het
Zfp804b A T 5: 6,771,481 D491E probably damaging Het
Other mutations in Ighg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ighg2b APN 12 113307036 missense possibly damaging 0.79
IGL01837:Ighg2b APN 12 113306445 missense unknown
IGL01973:Ighg2b APN 12 113307685 missense unknown
IGL01998:Ighg2b APN 12 113307089 missense unknown
IGL02147:Ighg2b APN 12 113306391 makesense probably null
IGL02183:Ighg2b APN 12 113307829 missense unknown
IGL03089:Ighg2b APN 12 113306678 missense probably damaging 1.00
PIT4453001:Ighg2b UTSW 12 113306872 missense unknown
R4199:Ighg2b UTSW 12 113307287 missense probably damaging 0.96
R4577:Ighg2b UTSW 12 113306892 missense unknown
R4589:Ighg2b UTSW 12 113306484 missense unknown
R4807:Ighg2b UTSW 12 113304345 unclassified probably benign
R4822:Ighg2b UTSW 12 113306391 makesense probably null
R5424:Ighg2b UTSW 12 113307930 missense unknown
R5641:Ighg2b UTSW 12 113307147 missense unknown
R6297:Ighg2b UTSW 12 113306892 missense unknown
R6701:Ighg2b UTSW 12 113307079 missense unknown
R6703:Ighg2b UTSW 12 113305033 unclassified probably benign
R6880:Ighg2b UTSW 12 113307106 missense
R7342:Ighg2b UTSW 12 113306430 missense
R7505:Ighg2b UTSW 12 113304980 missense
Predicted Primers PCR Primer
(F):5'- TCATGGCTGAAGTGGAAGGC -3'
(R):5'- GTGGACCATCCGTCTTCATC -3'

Sequencing Primer
(F):5'- TGGAAGGCTGTCCACATAGAC -3'
(R):5'- TCTTCCCTCCAAATATCAAGGATG -3'
Posted On2015-07-21