Incidental Mutation 'R4491:Taf1'
ID330757
Institutional Source Beutler Lab
Gene Symbol Taf1
Ensembl Gene ENSMUSG00000031314
Gene NameTATA-box binding protein associated factor 1
SynonymsTaf2a, KAT4, Ccg-1, B430306D02Rik, Ccg1
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4491 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101532734-101601789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101543059 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 313 (M313I)
Ref Sequence ENSEMBL: ENSMUSP00000098895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101341] [ENSMUST00000118878] [ENSMUST00000143908] [ENSMUST00000149274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101341
AA Change: M313I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098895
Gene: ENSMUSG00000031314
AA Change: M313I

DomainStartEndE-ValueType
Pfam:TBP-binding 23 86 3.1e-25 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 259 267 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Pfam:DUF3591 592 1055 6.7e-171 PFAM
low complexity region 1111 1123 N/A INTRINSIC
coiled coil region 1132 1168 N/A INTRINSIC
coiled coil region 1244 1277 N/A INTRINSIC
Pfam:zf-CCHC_6 1293 1332 1e-18 PFAM
low complexity region 1373 1390 N/A INTRINSIC
BROMO 1410 1518 6.27e-32 SMART
BROMO 1532 1641 1.42e-39 SMART
low complexity region 1655 1666 N/A INTRINSIC
low complexity region 1668 1679 N/A INTRINSIC
low complexity region 1720 1734 N/A INTRINSIC
low complexity region 1751 1767 N/A INTRINSIC
low complexity region 1775 1789 N/A INTRINSIC
low complexity region 1856 1866 N/A INTRINSIC
low complexity region 1880 1888 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118878
AA Change: M313I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112772
Gene: ENSMUSG00000031314
AA Change: M313I

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 1.4e-26 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 259 267 N/A INTRINSIC
low complexity region 522 538 N/A INTRINSIC
Pfam:DUF3591 565 1028 5.1e-158 PFAM
low complexity region 1084 1096 N/A INTRINSIC
coiled coil region 1105 1136 N/A INTRINSIC
coiled coil region 1212 1245 N/A INTRINSIC
Pfam:zf-CCHC_6 1261 1300 1.2e-17 PFAM
low complexity region 1341 1358 N/A INTRINSIC
BROMO 1378 1486 6.27e-32 SMART
BROMO 1500 1609 1.42e-39 SMART
low complexity region 1623 1634 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1688 1702 N/A INTRINSIC
low complexity region 1719 1735 N/A INTRINSIC
low complexity region 1743 1757 N/A INTRINSIC
low complexity region 1824 1834 N/A INTRINSIC
low complexity region 1848 1856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143908
AA Change: M334I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138159
Gene: ENSMUSG00000031314
AA Change: M334I

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 3.1e-27 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 185 212 N/A INTRINSIC
low complexity region 280 288 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:DUF3591 586 1049 7.1e-159 PFAM
low complexity region 1105 1117 N/A INTRINSIC
coiled coil region 1126 1157 N/A INTRINSIC
coiled coil region 1233 1266 N/A INTRINSIC
Pfam:zf-CCHC_6 1282 1321 4.4e-18 PFAM
low complexity region 1362 1379 N/A INTRINSIC
BROMO 1399 1507 6.27e-32 SMART
BROMO 1521 1630 1.42e-39 SMART
low complexity region 1644 1655 N/A INTRINSIC
low complexity region 1657 1668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149274
AA Change: M334I

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114765
Gene: ENSMUSG00000031314
AA Change: M334I

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 8.3e-28 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 185 212 N/A INTRINSIC
low complexity region 280 288 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:DUF3591 586 710 1.5e-28 PFAM
Meta Mutation Damage Score 0.0921 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N- and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. Mutations in this gene result in Dystonia 3, torsion, X-linked, a dystonia-parkinsonism disorder. Alternative splicing of this gene results in multiple transcript variants. This gene is part of a complex transcription unit (TAF1/DYT3), wherein some transcript variants share exons with TAF1 as well as additional downstream DYT3 exons. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Taf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Taf1 APN X 101562939 missense probably damaging 0.99
IGL01519:Taf1 APN X 101562806 splice site probably benign
R1768:Taf1 UTSW X 101540894 missense probably benign 0.37
R1867:Taf1 UTSW X 101562957 missense probably damaging 1.00
R4242:Taf1 UTSW X 101544503 missense probably benign
R4492:Taf1 UTSW X 101543059 missense possibly damaging 0.93
R4582:Taf1 UTSW X 101593995 missense possibly damaging 0.51
Z1176:Taf1 UTSW X 101596244 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCAGAGTTGATGATGCTAC -3'
(R):5'- CCAGAGTTGCTTACCTTCATTATG -3'

Sequencing Primer
(F):5'- CAGAGTTGATGATGCTACATTGC -3'
(R):5'- TTGTAGATTCATGTTCAGTCTTCTTC -3'
Posted On2015-07-21