Incidental Mutation 'R4491:Olfr683'
ID330730
Institutional Source Beutler Lab
Gene Symbol Olfr683
Ensembl Gene ENSMUSG00000044120
Gene Nameolfactory receptor 683
SynonymsGA_x6K02T2PBJ9-7773007-7772066, MOR40-1
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105140839-105147012 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105143776 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000148110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061284] [ENSMUST00000209879]
Predicted Effect probably null
Transcript: ENSMUST00000061284
AA Change: C178*
SMART Domains Protein: ENSMUSP00000060527
Gene: ENSMUSG00000044120
AA Change: C178*

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 8.5e-73 PFAM
Pfam:7TM_GPCR_Srsx 44 315 3.5e-8 PFAM
Pfam:7tm_1 50 300 1.3e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209879
AA Change: C172*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211388
Meta Mutation Damage Score 0.9463 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Olfr683
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr683 APN 7 105143604 missense possibly damaging 0.48
IGL01984:Olfr683 APN 7 105143716 missense probably benign 0.00
IGL02456:Olfr683 APN 7 105143759 missense probably damaging 0.99
IGL03242:Olfr683 APN 7 105144266 missense probably benign 0.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R0234:Olfr683 UTSW 7 105144074 missense probably damaging 1.00
R1282:Olfr683 UTSW 7 105143652 missense probably benign 0.01
R1485:Olfr683 UTSW 7 105143681 missense probably benign 0.00
R1653:Olfr683 UTSW 7 105143870 missense possibly damaging 0.80
R2130:Olfr683 UTSW 7 105143550 missense probably benign 0.03
R2355:Olfr683 UTSW 7 105143813 missense probably benign 0.11
R4826:Olfr683 UTSW 7 105143968 missense probably damaging 0.99
R4980:Olfr683 UTSW 7 105144224 missense probably benign
R5934:Olfr683 UTSW 7 105143660 missense probably benign 0.12
R6354:Olfr683 UTSW 7 105143708 missense probably benign 0.04
R7371:Olfr683 UTSW 7 105143879 missense possibly damaging 0.82
R7463:Olfr683 UTSW 7 105143937 missense probably benign 0.00
R7753:Olfr683 UTSW 7 105143800 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACATGTGCTCAGGGCTTTGG -3'
(R):5'- GTTTCCTGACGATGGAGTCC -3'

Sequencing Primer
(F):5'- CTGCTTTGATCCTGAGCACAG -3'
(R):5'- GATGGAGTCCTGCACCTTCATG -3'
Posted On2015-07-21