Incidental Mutation 'R4540:Pcdha1'
ID333515
Institutional Source Beutler Lab
Gene Symbol Pcdha1
Ensembl Gene ENSMUSG00000103442
Gene Nameprotocadherin alpha 1
Synonyms
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36930184-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 36931627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 448 (D448A)
Ref Sequence ENSEMBL: ENSMUSP00000142308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000193839]
Predicted Effect probably damaging
Transcript: ENSMUST00000070797
AA Change: D448A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442
AA Change: D448A

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192440
Predicted Effect probably damaging
Transcript: ENSMUST00000193839
AA Change: D448A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442
AA Change: D448A

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Meta Mutation Damage Score 0.9024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cd1d1 A G 3: 86,996,705 I194T probably benign Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Pcdha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdha1 APN 18 36932175 missense probably damaging 0.99
R0062:Pcdha1 UTSW 18 37006628 missense probably benign 0.08
R0108:Pcdha1 UTSW 18 36998756 missense probably benign
R0543:Pcdha1 UTSW 18 37185068 missense probably damaging 1.00
R1599:Pcdha1 UTSW 18 37185237 missense probably damaging 1.00
R1717:Pcdha1 UTSW 18 36932184 missense probably benign 0.01
R2301:Pcdha1 UTSW 18 37156183 missense probably damaging 1.00
R3038:Pcdha1 UTSW 18 36931011 missense probably damaging 1.00
R3086:Pcdha1 UTSW 18 36930948 missense possibly damaging 0.95
R3693:Pcdha1 UTSW 18 36932308 missense possibly damaging 0.95
R3783:Pcdha1 UTSW 18 36930802 missense probably damaging 1.00
R3881:Pcdha1 UTSW 18 36931401 missense possibly damaging 0.91
R4012:Pcdha1 UTSW 18 36931136 missense probably benign 0.02
R4597:Pcdha1 UTSW 18 36931906 missense possibly damaging 0.64
R4678:Pcdha1 UTSW 18 36930912 missense probably benign 0.00
R4998:Pcdha1 UTSW 18 36932416 missense probably damaging 1.00
R5466:Pcdha1 UTSW 18 36932259 missense possibly damaging 0.73
R5518:Pcdha1 UTSW 18 36932362 missense probably benign 0.23
R5673:Pcdha1 UTSW 18 36930673 missense probably damaging 1.00
R5925:Pcdha1 UTSW 18 36930671 missense probably damaging 1.00
R5942:Pcdha1 UTSW 18 36930391 missense probably damaging 1.00
R5963:Pcdha1 UTSW 18 36931171 missense probably damaging 0.99
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6107:Pcdha1 UTSW 18 36932301 missense probably benign 0.00
R6329:Pcdha1 UTSW 18 36932248 missense probably damaging 1.00
R6479:Pcdha1 UTSW 18 36931456 missense probably benign 0.28
R6503:Pcdha1 UTSW 18 36931671 missense probably damaging 1.00
R6907:Pcdha1 UTSW 18 36931071 missense probably benign 0.01
R7011:Pcdha1 UTSW 18 36930535 missense probably damaging 1.00
R7030:Pcdha1 UTSW 18 37159273 missense probably damaging 0.97
R7314:Pcdha1 UTSW 18 36931500 missense probably damaging 0.99
R7343:Pcdha1 UTSW 18 36930649 missense probably damaging 1.00
R7699:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7700:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7768:Pcdha1 UTSW 18 36932167 missense probably damaging 1.00
R7780:Pcdha1 UTSW 18 36932458 missense probably benign 0.28
R7800:Pcdha1 UTSW 18 36931373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGACTCAGGTGTCAACGG -3'
(R):5'- GTGCACAGACACATAGCTCG -3'

Sequencing Primer
(F):5'- AGGTGACCTGCTCCCTAAC -3'
(R):5'- GCTGACACCGTGAAGAT -3'
Posted On2015-08-18