Incidental Mutation 'R4540:Cd1d1'
ID333481
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene NameCD1d1 antigen
SynonymsCD1.1, Cd1d, Cd1a, Ly-38
MMRRC Submission 041776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4540 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86995834-86999441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86996705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 194 (I194T)
Ref Sequence ENSEMBL: ENSMUSP00000070616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
Predicted Effect probably benign
Transcript: ENSMUST00000029717
AA Change: I325T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: I325T

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
AA Change: I194T

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076
AA Change: I194T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142793
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A T 12: 113,544,499 H164L probably damaging Het
Arrdc3 C A 13: 80,890,671 R31S possibly damaging Het
Baiap3 C T 17: 25,246,670 V585M probably damaging Het
Braf A G 6: 39,644,333 S391P probably damaging Het
Ccdc51 T C 9: 109,092,220 F392L possibly damaging Het
Cep162 T C 9: 87,212,939 K806E probably damaging Het
Cntn4 A G 6: 106,675,748 E726G probably damaging Het
Col11a1 A G 3: 114,097,166 Y384C unknown Het
Cops3 A T 11: 59,830,154 L145H probably damaging Het
Cul9 C T 17: 46,503,089 M2286I probably null Het
Echdc1 G A 10: 29,344,582 V245I probably benign Het
Fsip2 A T 2: 82,951,665 M261L probably benign Het
Gm4353 A G 7: 116,083,977 L123P probably benign Het
Hcfc2 G C 10: 82,732,647 E42Q probably benign Het
Hfm1 A C 5: 106,874,221 Y199* probably null Het
Iba57 G A 11: 59,163,078 probably benign Het
Ihh T A 1: 74,948,399 N161I possibly damaging Het
Kcnh7 A G 2: 62,739,186 S789P probably damaging Het
Kndc1 C A 7: 139,921,427 C877* probably null Het
Lhcgr A G 17: 88,755,608 I212T probably benign Het
Lrrtm2 T A 18: 35,213,146 T368S probably benign Het
Mag A C 7: 30,900,729 V500G probably damaging Het
Nadsyn1 A G 7: 143,803,223 V512A probably damaging Het
Nlrp3 G A 11: 59,551,899 C759Y possibly damaging Het
Nup107 T C 10: 117,762,020 probably null Het
Olfr1305 T C 2: 111,873,201 Y218C probably damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Pcdha1 A C 18: 36,931,627 D448A probably damaging Het
Pitrm1 T A 13: 6,555,470 probably null Het
Pth2r A G 1: 65,282,201 N13S probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Selenoi A G 5: 30,256,087 D107G probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spag17 C T 3: 100,088,381 P1779S probably damaging Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Tbc1d30 T C 10: 121,279,158 E365G probably damaging Het
Tnxb C T 17: 34,703,335 T2374I possibly damaging Het
Trip12 A G 1: 84,749,276 I1T probably damaging Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86998173 missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86996588 missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86998881 missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86998161 missense probably benign
R0350:Cd1d1 UTSW 3 86997573 missense probably benign 0.11
R1771:Cd1d1 UTSW 3 86998665 missense possibly damaging 0.85
R2407:Cd1d1 UTSW 3 86998182 missense probably damaging 1.00
R3906:Cd1d1 UTSW 3 86998756 missense probably damaging 1.00
R4976:Cd1d1 UTSW 3 86998651 missense probably benign 0.00
R5303:Cd1d1 UTSW 3 86998120 missense probably benign 0.22
R5786:Cd1d1 UTSW 3 86998788 missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86998702 missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86998257 missense probably benign 0.00
R7315:Cd1d1 UTSW 3 86998113 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTCATCCCCAGATCCTGAGC -3'
(R):5'- GCCAGATCCTGATCATGAGAAATGG -3'

Sequencing Primer
(F):5'- ACTGAAGTCCTAGAGCCTGG -3'
(R):5'- TCCTGATCATGAGAAATGGAATGG -3'
Posted On2015-08-18