Incidental Mutation 'R4541:Ddhd1'
ID 333550
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
MMRRC Submission 041777-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4541 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 45860313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 140 (R140*)
Ref Sequence ENSEMBL: ENSMUSP00000154065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051310
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087320
AA Change: R351*
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: R351*

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111828
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect probably benign
Transcript: ENSMUST00000141487
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147551
Predicted Effect silent
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect probably null
Transcript: ENSMUST00000226301
AA Change: R140*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,769,676 (GRCm39) P73S probably benign Het
4930533L02Rik G A 7: 124,917,750 (GRCm39) noncoding transcript Het
Acot4 A T 12: 84,090,022 (GRCm39) I240F probably benign Het
B4galt6 A G 18: 20,878,496 (GRCm39) V10A probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Ccnb3 T C X: 6,875,308 (GRCm39) T424A probably benign Het
Cd8a A T 6: 71,350,856 (GRCm39) D107V probably benign Het
Cdca7l T C 12: 117,836,098 (GRCm39) S190P probably damaging Het
Ceacam12 G A 7: 17,805,648 (GRCm39) M278I probably benign Het
Cfap43 C T 19: 47,736,454 (GRCm39) V1346I probably benign Het
Clic5 C T 17: 44,552,956 (GRCm39) T70M probably damaging Het
Dbpht2 A T 12: 74,345,934 (GRCm39) noncoding transcript Het
Evpl T G 11: 116,123,470 (GRCm39) I301L probably benign Het
Glul T A 1: 153,778,782 (GRCm39) Y30* probably null Het
Itgad A T 7: 127,797,287 (GRCm39) H878L probably benign Het
Kcnk10 A G 12: 98,402,536 (GRCm39) I301T probably damaging Het
Klhl14 A T 18: 21,687,696 (GRCm39) Y575* probably null Het
Mrps2 G T 2: 28,358,412 (GRCm39) probably benign Het
Mymx GCC GC 17: 45,912,519 (GRCm39) probably null Het
Napb G A 2: 148,551,229 (GRCm39) probably benign Het
Nlrp1c-ps A G 11: 71,171,706 (GRCm39) noncoding transcript Het
Or10g9b A C 9: 39,917,589 (GRCm39) S219A possibly damaging Het
Or4f15 A G 2: 111,813,981 (GRCm39) I146T probably benign Het
Piwil4 C A 9: 14,629,612 (GRCm39) M438I probably damaging Het
Pla2r1 C T 2: 60,258,082 (GRCm39) D1199N probably damaging Het
Pmpca T G 2: 26,280,201 (GRCm39) probably benign Het
Prkcq G T 2: 11,288,623 (GRCm39) M525I possibly damaging Het
Rnf225 T C 7: 12,662,520 (GRCm39) probably null Het
Sco1 G T 11: 66,943,668 (GRCm39) A50S probably benign Het
Slc12a2 T A 18: 58,046,037 (GRCm39) probably null Het
Slc36a1 T C 11: 55,112,849 (GRCm39) V148A probably benign Het
Sost G A 11: 101,857,670 (GRCm39) P44S probably damaging Het
Tbc1d10c G T 19: 4,239,473 (GRCm39) R96S probably damaging Het
Tbc1d2b A T 9: 90,087,222 (GRCm39) I919N probably damaging Het
Tcea1 T C 1: 4,963,659 (GRCm39) L233P probably damaging Het
Tlcd4 A G 3: 121,028,884 (GRCm39) M1T probably null Het
Tmem231 T C 8: 112,641,224 (GRCm39) T223A probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tomm34 A G 2: 163,896,719 (GRCm39) Y243H probably benign Het
Tubgcp4 A T 2: 121,025,907 (GRCm39) N584I probably benign Het
Vldlr T C 19: 27,216,192 (GRCm39) C7R probably damaging Het
Vmn1r42 A T 6: 89,822,533 (GRCm39) M12K probably benign Het
Vsig10 C T 5: 117,490,881 (GRCm39) probably benign Het
Zfp974 C G 7: 27,625,829 (GRCm39) V14L probably damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45,842,566 (GRCm39) missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6218:Ddhd1 UTSW 14 45,851,633 (GRCm39) missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45,894,689 (GRCm39) frame shift probably null
R6787:Ddhd1 UTSW 14 45,894,976 (GRCm39) missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45,840,138 (GRCm39) missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCAAAACTCTGTTCCTCTGCAAAC -3'
(R):5'- AGTGCAGTTTCTAAAAGTTAGGGC -3'

Sequencing Primer
(F):5'- CCTCTGCAAACCAGTTATATATAGTC -3'
(R):5'- GTTTCTAAAAGTTAGGGCTAAAAGGC -3'
Posted On 2015-08-18