Incidental Mutation 'R6787:Ddhd1'
ID 543674
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
MMRRC Submission 044901-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6787 (G1)
Quality Score 77.0075
Status Validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45894976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 165 (T165A)
Ref Sequence ENSEMBL: ENSMUSP00000118848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286] [ENSMUST00000226301]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051310
AA Change: T165A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: T165A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087320
AA Change: T165A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: T165A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111828
AA Change: T165A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: T165A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149286
AA Change: T165A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697
AA Change: T165A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226301
Meta Mutation Damage Score 0.0913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,126,768 (GRCm39) T32I probably benign Het
4930486L24Rik T A 13: 61,000,922 (GRCm39) I205L probably benign Het
Aatk C T 11: 119,901,508 (GRCm39) V963M probably damaging Het
Adra1b C A 11: 43,726,242 (GRCm39) R225L probably damaging Het
Adrb1 T C 19: 56,711,021 (GRCm39) V73A probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
BC035947 G T 1: 78,475,527 (GRCm39) P335Q possibly damaging Het
C2cd3 T C 7: 100,104,553 (GRCm39) F2189L probably benign Het
Capn9 A G 8: 125,342,924 (GRCm39) I635V probably benign Het
Cep55 T A 19: 38,046,374 (GRCm39) D42E probably benign Het
Cftr T A 6: 18,274,607 (GRCm39) Y878* probably null Het
Clpb A T 7: 101,312,866 (GRCm39) probably benign Het
Cpeb3 T C 19: 37,022,089 (GRCm39) I569V possibly damaging Het
Cpne6 A T 14: 55,752,701 (GRCm39) D297V probably damaging Het
Fam98b T C 2: 117,093,402 (GRCm39) probably null Het
Frem2 T C 3: 53,561,744 (GRCm39) N921S probably benign Het
Gbf1 T A 19: 46,260,211 (GRCm39) V1039E probably benign Het
Gmip A G 8: 70,266,436 (GRCm39) E212G probably damaging Het
Gpcpd1 C T 2: 132,379,758 (GRCm39) probably benign Het
Gtf2ird1 A T 5: 134,392,766 (GRCm39) N796K probably damaging Het
Hadhb T C 5: 30,360,247 (GRCm39) probably benign Het
Itga4 T A 2: 79,119,609 (GRCm39) S472T probably damaging Het
Kcna4 G A 2: 107,125,670 (GRCm39) E135K possibly damaging Het
Kmt2c G T 5: 25,480,737 (GRCm39) probably null Het
Lama1 T C 17: 68,091,020 (GRCm39) I1620T unknown Het
Lins1 A G 7: 66,363,902 (GRCm39) E594G probably benign Het
Lrrc38 T A 4: 143,096,364 (GRCm39) M225K probably benign Het
Mphosph9 A G 5: 124,399,090 (GRCm39) I975T probably damaging Het
Mrgprh T C 17: 13,095,874 (GRCm39) F38S probably benign Het
Myo1h G A 5: 114,458,714 (GRCm39) G150R probably damaging Het
Oas2 T G 5: 120,876,863 (GRCm39) I391L possibly damaging Het
Or4a70 T A 2: 89,324,378 (GRCm39) R93* probably null Het
Or5p72 T C 7: 108,021,889 (GRCm39) I37T possibly damaging Het
Or6c3b T A 10: 129,527,391 (GRCm39) D173V possibly damaging Het
Or7e178 T C 9: 20,247,221 (GRCm39) D14G probably benign Het
Pdcd5 T C 7: 35,342,063 (GRCm39) T182A probably damaging Het
Pdlim7 T C 13: 55,656,810 (GRCm39) D48G probably damaging Het
Polr3b A C 10: 84,464,489 (GRCm39) probably null Het
Psmd5 C T 2: 34,747,649 (GRCm39) probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sdhb T C 4: 140,703,501 (GRCm39) Y208H probably damaging Het
Serinc5 G A 13: 92,842,740 (GRCm39) V397I possibly damaging Het
Sik2 A T 9: 50,909,834 (GRCm39) M73K possibly damaging Het
Slc41a1 A G 1: 131,770,487 (GRCm39) probably null Het
Slco1a1 T C 6: 141,882,213 (GRCm39) I119V probably benign Het
Srd5a1 T C 13: 69,759,418 (GRCm39) probably benign Het
Stab2 T C 10: 86,754,948 (GRCm39) I1111V probably benign Het
Stxbp6 G T 12: 44,949,779 (GRCm39) probably null Het
Tbc1d19 A G 5: 53,992,591 (GRCm39) probably null Het
Tnxb A T 17: 34,929,710 (GRCm39) T2815S probably benign Het
Txnip T A 3: 96,467,623 (GRCm39) I363N probably damaging Het
Zfp442 A T 2: 150,251,499 (GRCm39) N134K possibly damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45,842,566 (GRCm39) missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4541:Ddhd1 UTSW 14 45,860,313 (GRCm39) nonsense probably null
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6218:Ddhd1 UTSW 14 45,851,633 (GRCm39) missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45,894,689 (GRCm39) frame shift probably null
R7049:Ddhd1 UTSW 14 45,840,138 (GRCm39) missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTCCTTGAGTGACATCCACC -3'
(R):5'- TCGTCGTTGCGCTACTACAG -3'

Sequencing Primer
(F):5'- TGAGTGACATCCACCTCGTAG -3'
(R):5'- CTACTACAGCGAGGGCGAG -3'
Posted On 2019-05-03