Incidental Mutation 'R4583:Slc7a10'
ID 343826
Institutional Source Beutler Lab
Gene Symbol Slc7a10
Ensembl Gene ENSMUSG00000030495
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 10
Synonyms Asc-1, D7Bwg0847e
MMRRC Submission 041804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4583 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 34885810-34900539 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 34897377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048] [ENSMUST00000135452] [ENSMUST00000167441]
AlphaFold P63115
Predicted Effect probably null
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118444
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122409
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135452
SMART Domains Protein: ENSMUSP00000127577
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 125 1.5e-15 PFAM
Pfam:AA_permease 51 125 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect probably benign
Transcript: ENSMUST00000167441
SMART Domains Protein: ENSMUSP00000129954
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC7A10, in association with 4F2HC (SLC3A2; MIM 158070), mediates high-affinity transport of D-serine and several other neutral amino acids (Nakauchi et al., 2000 [PubMed 10863037]).[supplied by OMIM, Mar 2008]
PHENOTYPE: A targeted mutation of this gene results in mice that develop tremors, ataxia and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,274,017 (GRCm39) L86P unknown Het
Aimp1 C T 3: 132,382,808 (GRCm39) E23K probably damaging Het
Ap2b1 A T 11: 83,288,605 (GRCm39) N884I probably benign Het
Apoe G T 7: 19,431,423 (GRCm39) Q65K possibly damaging Het
Arhgef1 T A 7: 24,611,996 (GRCm39) D93E probably benign Het
Arhgef12 G T 9: 42,888,958 (GRCm39) T1085K probably damaging Het
Arid5a T C 1: 36,356,745 (GRCm39) probably null Het
Atp9a A T 2: 168,531,280 (GRCm39) probably null Het
Baz1a T C 12: 54,969,325 (GRCm39) I635V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cckar T A 5: 53,857,124 (GRCm39) M429L probably benign Het
Ccl3 A T 11: 83,539,164 (GRCm39) L65Q probably benign Het
Ccr3 A G 9: 123,829,477 (GRCm39) T271A probably benign Het
Cd8b1 T A 6: 71,303,081 (GRCm39) I52N probably damaging Het
Cdh15 G A 8: 123,591,767 (GRCm39) E551K probably damaging Het
Cdh17 A G 4: 11,810,466 (GRCm39) K719R probably benign Het
Cfap43 T C 19: 47,825,655 (GRCm39) R38G probably null Het
Chd6 T C 2: 160,856,114 (GRCm39) E715G probably damaging Het
Cldn34b2 T A X: 153,908,625 (GRCm39) R68* probably null Het
Col19a1 T G 1: 24,600,410 (GRCm39) D44A unknown Het
Colgalt2 C T 1: 152,382,627 (GRCm39) S493F probably damaging Het
Cr1l T C 1: 194,812,139 (GRCm39) I99M probably damaging Het
Crybg1 T C 10: 43,873,616 (GRCm39) E1164G probably damaging Het
Cym G T 3: 107,118,718 (GRCm39) D367E probably damaging Het
Dennd2a G T 6: 39,499,776 (GRCm39) T263K probably damaging Het
Dhx9 T A 1: 153,336,049 (GRCm39) M869L probably damaging Het
Dnm2 A G 9: 21,415,742 (GRCm39) H692R probably damaging Het
Ern1 A T 11: 106,298,031 (GRCm39) S697T probably damaging Het
F12 G A 13: 55,568,943 (GRCm39) T273I probably benign Het
Fam151b A T 13: 92,604,617 (GRCm39) L124Q probably damaging Het
Fancg A G 4: 43,002,991 (GRCm39) V622A probably benign Het
Fbxo2 T A 4: 148,249,356 (GRCm39) N159K possibly damaging Het
Fgd2 C A 17: 29,586,052 (GRCm39) T212K possibly damaging Het
Fhl3 T A 4: 124,601,342 (GRCm39) D178E probably benign Het
Filip1 G T 9: 79,723,091 (GRCm39) A1176D possibly damaging Het
Fndc1 T C 17: 7,958,081 (GRCm39) Y1722C probably damaging Het
Frem3 T C 8: 81,340,143 (GRCm39) V812A probably benign Het
Fsip2 A G 2: 82,809,017 (GRCm39) I1779V probably benign Het
Gli2 C T 1: 118,769,798 (GRCm39) V585I probably benign Het
Gm15056 C G 8: 21,390,697 (GRCm39) S80T probably benign Het
Gm5145 A G 17: 20,790,715 (GRCm39) E31G probably benign Het
Gmfg A G 7: 28,145,369 (GRCm39) Y71C probably damaging Het
Grk1 A G 8: 13,459,322 (GRCm39) E291G probably damaging Het
Gtpbp1 A G 15: 79,600,152 (GRCm39) E393G possibly damaging Het
Gtpbp2 A G 17: 46,472,071 (GRCm39) D2G probably damaging Het
Hc A T 2: 34,918,189 (GRCm39) V698E probably benign Het
Helz G A 11: 107,536,895 (GRCm39) R249H probably damaging Het
Hmcn2 A G 2: 31,303,277 (GRCm39) I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,493,950 (GRCm39) R286G probably benign Het
Hus1b A T 13: 31,131,501 (GRCm39) W53R probably damaging Het
Hydin C T 8: 111,321,857 (GRCm39) T4503I probably benign Het
Ighmbp2 G C 19: 3,315,324 (GRCm39) P699A probably benign Het
Igkv1-122 A T 6: 67,994,442 (GRCm39) Y110F probably benign Het
Igkv8-28 T C 6: 70,120,604 (GRCm39) Y113C probably damaging Het
Iigp1c T C 18: 60,379,152 (GRCm39) I229T possibly damaging Het
Il16 A G 7: 83,332,107 (GRCm39) S158P probably damaging Het
Kalrn T A 16: 34,055,637 (GRCm39) H876L probably damaging Het
Kdm5d T A Y: 914,134 (GRCm39) L357H probably damaging Het
Krt78 T C 15: 101,855,055 (GRCm39) T919A possibly damaging Het
L3mbtl2 T C 15: 81,569,107 (GRCm39) C594R probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lgals3 A T 14: 47,619,144 (GRCm39) probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lpcat3 T G 6: 124,680,286 (GRCm39) W429G possibly damaging Het
Lrp1 T C 10: 127,377,241 (GRCm39) T4149A probably benign Het
Memo1 G A 17: 74,565,456 (GRCm39) Q36* probably null Het
Mical2 A G 7: 112,012,154 (GRCm39) N668S probably benign Het
Ms4a10 A T 19: 10,945,553 (GRCm39) I76N possibly damaging Het
Mthfr T G 4: 148,136,329 (GRCm39) L362V possibly damaging Het
Myh3 T A 11: 66,987,279 (GRCm39) Y1376* probably null Het
Mymk C A 2: 26,952,292 (GRCm39) V192F probably benign Het
Myo1c A G 11: 75,562,688 (GRCm39) D966G possibly damaging Het
Ncam2 A G 16: 81,314,445 (GRCm39) N474D probably damaging Het
Nmnat1 T C 4: 149,553,608 (GRCm39) N168S possibly damaging Het
Nmur1 C T 1: 86,314,367 (GRCm39) V323M possibly damaging Het
Npr2 C A 4: 43,633,522 (GRCm39) probably null Het
Nsd3 T A 8: 26,200,703 (GRCm39) M1265K probably benign Het
Or13c7 A G 4: 43,855,262 (GRCm39) T318A probably benign Het
Or1e34 T C 11: 73,778,629 (GRCm39) T190A probably damaging Het
Or1j16 A C 2: 36,530,626 (GRCm39) T192P probably damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or4c11 G T 2: 88,695,838 (GRCm39) M296I probably benign Het
Or5b108 T A 19: 13,168,062 (GRCm39) F10L probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Or6c216 T C 10: 129,678,344 (GRCm39) D189G probably damaging Het
Otub1 G A 19: 7,181,801 (GRCm39) A25V possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl2 A G 2: 121,957,226 (GRCm39) S103P probably benign Het
Pcdhb15 A T 18: 37,608,628 (GRCm39) H620L possibly damaging Het
Pdgfc A T 3: 81,048,835 (GRCm39) D81V possibly damaging Het
Pdia2 T C 17: 26,415,476 (GRCm39) D447G probably damaging Het
Pold1 C A 7: 44,188,337 (GRCm39) A514S probably damaging Het
Pomgnt1 C T 4: 116,015,691 (GRCm39) T552I probably benign Het
Ppl T C 16: 4,922,400 (GRCm39) E294G probably benign Het
Pramel12 A G 4: 143,143,324 (GRCm39) Y30C probably damaging Het
Prkcb A G 7: 122,056,447 (GRCm39) S100G probably benign Het
Psg16 T G 7: 16,829,097 (GRCm39) I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 122,601,175 (GRCm39) probably benign Het
Reck T C 4: 43,931,062 (GRCm39) probably null Het
Rrbp1 C T 2: 143,830,671 (GRCm39) G499S probably benign Het
Sema6d G T 2: 124,506,082 (GRCm39) R630L probably damaging Het
Slc29a1 A G 17: 45,900,882 (GRCm39) V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 (GRCm39) Q324L probably benign Het
Slc35c1 A T 2: 92,289,266 (GRCm39) L80Q probably damaging Het
Srrm2 C T 17: 24,038,593 (GRCm39) probably benign Het
Stk38 T G 17: 29,201,130 (GRCm39) D182A probably damaging Het
Tas2r104 C T 6: 131,662,398 (GRCm39) G104S probably benign Het
Tmem121b T C 6: 120,469,055 (GRCm39) E554G probably damaging Het
Tor1aip2 A G 1: 155,940,888 (GRCm39) H398R probably benign Het
Tram2 C T 1: 21,083,673 (GRCm39) V83I probably benign Het
Ube3a C T 7: 58,935,811 (GRCm39) T565I probably damaging Het
Ubr4 T C 4: 139,108,164 (GRCm39) V56A possibly damaging Het
Vmn1r128 T C 7: 21,083,644 (GRCm39) V116A possibly damaging Het
Vmn1r170 C T 7: 23,306,087 (GRCm39) T163I probably benign Het
Vmn2r75 T A 7: 85,813,290 (GRCm39) D504V possibly damaging Het
Vps36 G A 8: 22,708,436 (GRCm39) M363I probably benign Het
Wdsub1 A G 2: 59,708,661 (GRCm39) S71P probably damaging Het
Zdhhc12 A G 2: 29,981,496 (GRCm39) F189L probably benign Het
Zfp521 T C 18: 13,977,387 (GRCm39) M1009V probably benign Het
Other mutations in Slc7a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Slc7a10 APN 7 34,885,917 (GRCm39) missense possibly damaging 0.90
IGL02728:Slc7a10 APN 7 34,897,123 (GRCm39) missense probably damaging 1.00
IGL02892:Slc7a10 APN 7 34,894,593 (GRCm39) missense possibly damaging 0.67
R0671:Slc7a10 UTSW 7 34,896,758 (GRCm39) missense probably benign 0.00
R1943:Slc7a10 UTSW 7 34,899,723 (GRCm39) missense probably benign 0.07
R3743:Slc7a10 UTSW 7 34,898,325 (GRCm39) missense probably damaging 0.99
R4256:Slc7a10 UTSW 7 34,898,140 (GRCm39) missense probably damaging 0.96
R4638:Slc7a10 UTSW 7 34,897,355 (GRCm39) missense probably damaging 1.00
R4749:Slc7a10 UTSW 7 34,900,187 (GRCm39) missense probably damaging 1.00
R5023:Slc7a10 UTSW 7 34,896,780 (GRCm39) missense possibly damaging 0.48
R5755:Slc7a10 UTSW 7 34,898,336 (GRCm39) missense probably damaging 0.99
R6247:Slc7a10 UTSW 7 34,886,012 (GRCm39) missense possibly damaging 0.57
R6430:Slc7a10 UTSW 7 34,897,083 (GRCm39) missense probably benign
R6450:Slc7a10 UTSW 7 34,886,015 (GRCm39) missense possibly damaging 0.83
R6814:Slc7a10 UTSW 7 34,894,689 (GRCm39) missense probably damaging 0.98
R7026:Slc7a10 UTSW 7 34,898,139 (GRCm39) missense probably damaging 1.00
R7110:Slc7a10 UTSW 7 34,899,009 (GRCm39) missense probably benign
R7923:Slc7a10 UTSW 7 34,894,554 (GRCm39) missense probably damaging 0.98
R8000:Slc7a10 UTSW 7 34,899,865 (GRCm39) missense
R8680:Slc7a10 UTSW 7 34,885,997 (GRCm39) missense probably benign 0.34
R8827:Slc7a10 UTSW 7 34,897,313 (GRCm39) missense probably damaging 1.00
R8940:Slc7a10 UTSW 7 34,899,875 (GRCm39) missense probably benign 0.03
R9224:Slc7a10 UTSW 7 34,894,639 (GRCm39) nonsense probably null
Z1176:Slc7a10 UTSW 7 34,899,755 (GRCm39) missense probably damaging 1.00
Z1186:Slc7a10 UTSW 7 34,885,956 (GRCm39) missense probably benign
Z1191:Slc7a10 UTSW 7 34,885,956 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCAAGGTAAAACCAGGGTGG -3'
(R):5'- TCTTTCTGAGGCCCCACAAG -3'

Sequencing Primer
(F):5'- ACTTGGGAGACTGTGCTAACC -3'
(R):5'- ACAAGGGGCCCAGTTGCAG -3'
Posted On 2015-09-24