Incidental Mutation 'R4583:Frem3'
ID343838
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 041804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4583 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80613514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 812 (V812A)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably benign
Transcript: ENSMUST00000039695
AA Change: V812A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: V812A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,574,592 L86P unknown Het
Aimp1 C T 3: 132,677,047 E23K probably damaging Het
Ap2b1 A T 11: 83,397,779 N884I probably benign Het
Apoe G T 7: 19,697,498 Q65K possibly damaging Het
Arhgef1 T A 7: 24,912,571 D93E probably benign Het
Arhgef12 G T 9: 42,977,662 T1085K probably damaging Het
Arid5a T C 1: 36,317,664 probably null Het
Atp9a A T 2: 168,689,360 probably null Het
Baz1a T C 12: 54,922,540 I635V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cckar T A 5: 53,699,782 M429L probably benign Het
Ccl3 A T 11: 83,648,338 L65Q probably benign Het
Ccr3 A G 9: 124,029,440 T271A probably benign Het
Cd8b1 T A 6: 71,326,097 I52N probably damaging Het
Cdh15 G A 8: 122,865,028 E551K probably damaging Het
Cdh17 A G 4: 11,810,466 K719R probably benign Het
Cfap43 T C 19: 47,837,216 R38G probably null Het
Chd6 T C 2: 161,014,194 E715G probably damaging Het
Cldn34b2 T A X: 155,125,629 R68* probably null Het
Col19a1 T G 1: 24,561,329 D44A unknown Het
Colgalt2 C T 1: 152,506,876 S493F probably damaging Het
Cr1l T C 1: 195,129,831 I99M probably damaging Het
Crybg1 T C 10: 43,997,620 E1164G probably damaging Het
Cym G T 3: 107,211,402 D367E probably damaging Het
Dennd2a G T 6: 39,522,842 T263K probably damaging Het
Dhx9 T A 1: 153,460,303 M869L probably damaging Het
Dnm2 A G 9: 21,504,446 H692R probably damaging Het
Ern1 A T 11: 106,407,205 S697T probably damaging Het
F12 G A 13: 55,421,130 T273I probably benign Het
Fam151b A T 13: 92,468,109 L124Q probably damaging Het
Fancg A G 4: 43,002,991 V622A probably benign Het
Fbxo2 T A 4: 148,164,899 N159K possibly damaging Het
Fgd2 C A 17: 29,367,078 T212K possibly damaging Het
Fhl3 T A 4: 124,707,549 D178E probably benign Het
Filip1 G T 9: 79,815,809 A1176D possibly damaging Het
Fndc1 T C 17: 7,739,249 Y1722C probably damaging Het
Fsip2 A G 2: 82,978,673 I1779V probably benign Het
Gli2 C T 1: 118,842,068 V585I probably benign Het
Gm15056 C G 8: 20,900,681 S80T probably benign Het
Gm4951 T C 18: 60,246,080 I229T possibly damaging Het
Gm5145 A G 17: 20,570,453 E31G probably benign Het
Gmfg A G 7: 28,445,944 Y71C probably damaging Het
Grk1 A G 8: 13,409,322 E291G probably damaging Het
Gtpbp1 A G 15: 79,715,951 E393G possibly damaging Het
Gtpbp2 A G 17: 46,161,145 D2G probably damaging Het
Hc A T 2: 35,028,177 V698E probably benign Het
Helz G A 11: 107,646,069 R249H probably damaging Het
Hmcn2 A G 2: 31,413,265 I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,663,606 R286G probably benign Het
Hus1b A T 13: 30,947,518 W53R probably damaging Het
Hydin C T 8: 110,595,225 T4503I probably benign Het
Ighmbp2 G C 19: 3,265,324 P699A probably benign Het
Igkv1-122 A T 6: 68,017,458 Y110F probably benign Het
Igkv8-28 T C 6: 70,143,620 Y113C probably damaging Het
Il16 A G 7: 83,682,899 S158P probably damaging Het
Kalrn T A 16: 34,235,267 H876L probably damaging Het
Kdm5d T A Y: 914,134 L357H probably damaging Het
Krt78 T C 15: 101,946,620 T919A possibly damaging Het
L3mbtl2 T C 15: 81,684,906 C594R probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lgals3 A T 14: 47,381,687 probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lpcat3 T G 6: 124,703,323 W429G possibly damaging Het
Lrp1 T C 10: 127,541,372 T4149A probably benign Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Micalcl A G 7: 112,412,947 N668S probably benign Het
Ms4a10 A T 19: 10,968,189 I76N possibly damaging Het
Mthfr T G 4: 148,051,872 L362V possibly damaging Het
Myh3 T A 11: 67,096,453 Y1376* probably null Het
Mymk C A 2: 27,062,280 V192F probably benign Het
Myo1c A G 11: 75,671,862 D966G possibly damaging Het
Ncam2 A G 16: 81,517,557 N474D probably damaging Het
Nmnat1 T C 4: 149,469,151 N168S possibly damaging Het
Nmur1 C T 1: 86,386,645 V323M possibly damaging Het
Npr2 C A 4: 43,633,522 probably null Het
Nsd3 T A 8: 25,710,676 M1265K probably benign Het
Olfr1206 G T 2: 88,865,494 M296I probably benign Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1462 T A 19: 13,190,698 F10L probably damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr155 A G 4: 43,855,262 T318A probably benign Het
Olfr345 A C 2: 36,640,614 T192P probably damaging Het
Olfr394 T C 11: 73,887,803 T190A probably damaging Het
Olfr812 T C 10: 129,842,475 D189G probably damaging Het
Otub1 G A 19: 7,204,436 A25V possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl2 A G 2: 122,126,745 S103P probably benign Het
Pcdhb15 A T 18: 37,475,575 H620L possibly damaging Het
Pdgfc A T 3: 81,141,528 D81V possibly damaging Het
Pdia2 T C 17: 26,196,502 D447G probably damaging Het
Pold1 C A 7: 44,538,913 A514S probably damaging Het
Pomgnt1 C T 4: 116,158,494 T552I probably benign Het
Ppl T C 16: 5,104,536 E294G probably benign Het
Pramef8 A G 4: 143,416,754 Y30C probably damaging Het
Prkcb A G 7: 122,457,224 S100G probably benign Het
Psg16 T G 7: 17,095,172 I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 123,001,952 probably benign Het
Reck T C 4: 43,931,062 probably null Het
Rrbp1 C T 2: 143,988,751 G499S probably benign Het
Sema6d G T 2: 124,664,162 R630L probably damaging Het
Slc29a1 A G 17: 45,589,956 V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 Q324L probably benign Het
Slc35c1 A T 2: 92,458,921 L80Q probably damaging Het
Slc7a10 G T 7: 35,197,952 probably null Het
Srrm2 C T 17: 23,819,619 probably benign Het
Stk38 T G 17: 28,982,156 D182A probably damaging Het
Tas2r104 C T 6: 131,685,435 G104S probably benign Het
Tmem121b T C 6: 120,492,094 E554G probably damaging Het
Tor1aip2 A G 1: 156,065,142 H398R probably benign Het
Tram2 C T 1: 21,013,449 V83I probably benign Het
Ube3a C T 7: 59,286,063 T565I probably damaging Het
Ubr4 T C 4: 139,380,853 V56A possibly damaging Het
Vmn1r128 T C 7: 21,349,719 V116A possibly damaging Het
Vmn1r170 C T 7: 23,606,662 T163I probably benign Het
Vmn2r75 T A 7: 86,164,082 D504V possibly damaging Het
Vps36 G A 8: 22,218,420 M363I probably benign Het
Wdsub1 A G 2: 59,878,317 S71P probably damaging Het
Zdhhc12 A G 2: 30,091,484 F189L probably benign Het
Zfp521 T C 18: 13,844,330 M1009V probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGATTCACCAGGTAGACCC -3'
(R):5'- ATGCTCCCATTGATAACATCAGC -3'

Sequencing Primer
(F):5'- GATTCACCAGGTAGACCCATCGTTC -3'
(R):5'- AAAGTACTGCAAGTGTCCATGCTG -3'
Posted On2015-09-24