Incidental Mutation 'R4596:Arhgef40'
ID 344408
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor 40
Synonyms E130112L23Rik
MMRRC Submission 041812-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R4596 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 52222176-52243708 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 52224681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000183208] [ENSMUST00000182905] [ENSMUST00000182760] [ENSMUST00000182909]
AlphaFold Q3UPH7
Predicted Effect probably benign
Transcript: ENSMUST00000093813
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182193
Predicted Effect probably null
Transcript: ENSMUST00000182193
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182609
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182760
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182909
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,165,088 (GRCm39) K429E probably benign Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Adad1 T C 3: 37,119,341 (GRCm39) S141P probably damaging Het
Anapc4 T C 5: 52,999,060 (GRCm39) V124A probably benign Het
Anxa6 G T 11: 54,885,409 (GRCm39) probably null Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
Asz1 A T 6: 18,103,592 (GRCm39) I116K possibly damaging Het
Bcam T C 7: 19,498,082 (GRCm39) N314D probably damaging Het
Cfi T C 3: 129,662,149 (GRCm39) V376A probably damaging Het
Cipc A G 12: 87,008,728 (GRCm39) T196A probably benign Het
Cnksr1 A G 4: 133,961,189 (GRCm39) V225A possibly damaging Het
Col4a4 G A 1: 82,448,940 (GRCm39) P1217S unknown Het
Dync2h1 C T 9: 6,992,595 (GRCm39) D3996N probably benign Het
Fasl T C 1: 161,615,838 (GRCm39) N6S probably benign Het
Fhod3 A T 18: 25,248,775 (GRCm39) Q1318L probably benign Het
Gmps G T 3: 63,901,338 (GRCm39) E386* probably null Het
Hspa13 C T 16: 75,555,114 (GRCm39) G324D probably benign Het
Ift80 A G 3: 68,898,092 (GRCm39) V81A probably benign Het
Itgb1bp1 C A 12: 21,322,135 (GRCm39) L101F probably damaging Het
Jak3 T A 8: 72,137,275 (GRCm39) S779T probably damaging Het
Klhl21 G T 4: 152,096,997 (GRCm39) R421L probably benign Het
Mgat4c T C 10: 102,224,422 (GRCm39) F212S probably damaging Het
Msl3l2 T A 10: 55,991,741 (GRCm39) F155L probably benign Het
Nfat5 A G 8: 108,078,132 (GRCm39) K406E possibly damaging Het
Nsd2 A T 5: 34,040,262 (GRCm39) H933L probably damaging Het
Or4c31 A G 2: 88,292,538 (GRCm39) T304A probably benign Het
Or51h5 A G 7: 102,577,458 (GRCm39) T208A possibly damaging Het
Or6f1 A T 7: 85,970,631 (GRCm39) H176Q probably damaging Het
Or9q2 G A 19: 13,772,264 (GRCm39) T237I probably damaging Het
Paxbp1 T C 16: 90,827,435 (GRCm39) I467V probably benign Het
Pcdha8 A C 18: 37,126,611 (GRCm39) Q364H possibly damaging Het
Prr14l T C 5: 32,986,652 (GRCm39) T948A probably benign Het
Ptgfr A T 3: 151,507,430 (GRCm39) V311D probably damaging Het
Ptpn13 A G 5: 103,671,558 (GRCm39) Y495C probably benign Het
Sec61g A T 11: 16,458,127 (GRCm39) S23T probably benign Het
Sema3a G T 5: 13,620,125 (GRCm39) V458F probably damaging Het
Slc16a14 T A 1: 84,907,078 (GRCm39) E65D probably damaging Het
Slc35f6 T C 5: 30,805,406 (GRCm39) M14T probably damaging Het
Slc4a10 A T 2: 62,127,202 (GRCm39) I882F probably damaging Het
Sox17 C A 1: 4,562,860 (GRCm39) E48D possibly damaging Het
Thbs1 A T 2: 117,945,236 (GRCm39) I270F possibly damaging Het
Tia1 A G 6: 86,397,389 (GRCm39) I121V probably benign Het
Trim30d A T 7: 104,121,733 (GRCm39) H337Q probably benign Het
Tvp23b G A 11: 62,774,544 (GRCm39) A63T probably benign Het
U2surp C T 9: 95,367,681 (GRCm39) V437I probably damaging Het
Ube2i T C 17: 25,484,298 (GRCm39) probably benign Het
Vmn1r62 A G 7: 5,678,306 (GRCm39) probably benign Het
Wdr3 G A 3: 100,060,183 (GRCm39) S310F possibly damaging Het
Wdr72 A T 9: 74,058,887 (GRCm39) M327L probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 52,226,417 (GRCm39) missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 52,224,884 (GRCm39) missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 52,229,155 (GRCm39) critical splice donor site probably null
IGL01123:Arhgef40 APN 14 52,231,803 (GRCm39) missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 52,226,862 (GRCm39) missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 52,226,652 (GRCm39) missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52,238,320 (GRCm39) missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 52,234,865 (GRCm39) missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52,242,364 (GRCm39) unclassified probably benign
R0608:Arhgef40 UTSW 14 52,234,431 (GRCm39) missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52,238,450 (GRCm39) missense probably benign 0.05
R1126:Arhgef40 UTSW 14 52,234,583 (GRCm39) missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 52,227,613 (GRCm39) missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52,241,538 (GRCm39) missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 52,227,387 (GRCm39) missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 52,235,080 (GRCm39) missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52,241,162 (GRCm39) missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 52,233,640 (GRCm39) missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 52,231,733 (GRCm39) splice site probably benign
R3877:Arhgef40 UTSW 14 52,239,742 (GRCm39) missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 52,227,628 (GRCm39) missense possibly damaging 0.50
R4676:Arhgef40 UTSW 14 52,228,416 (GRCm39) nonsense probably null
R4703:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52,239,767 (GRCm39) missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52,242,395 (GRCm39) unclassified probably benign
R4915:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 52,227,556 (GRCm39) missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 52,227,146 (GRCm39) missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52,241,556 (GRCm39) missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 52,227,269 (GRCm39) missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 52,227,156 (GRCm39) missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 52,229,306 (GRCm39) missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 52,233,614 (GRCm39) missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 52,231,795 (GRCm39) missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52,238,357 (GRCm39) missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 52,234,489 (GRCm39) missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 52,224,953 (GRCm39) missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 52,227,547 (GRCm39) missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52,238,456 (GRCm39) missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 52,234,888 (GRCm39) missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 52,228,419 (GRCm39) unclassified probably benign
R6675:Arhgef40 UTSW 14 52,229,098 (GRCm39) missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 52,235,354 (GRCm39) intron probably benign
R6901:Arhgef40 UTSW 14 52,234,825 (GRCm39) missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 52,229,254 (GRCm39) missense unknown
R7857:Arhgef40 UTSW 14 52,226,212 (GRCm39) missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 52,225,032 (GRCm39) missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 52,222,452 (GRCm39) splice site probably benign
R8144:Arhgef40 UTSW 14 52,235,632 (GRCm39) missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 52,226,226 (GRCm39) missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 52,226,857 (GRCm39) missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52,238,414 (GRCm39) missense probably damaging 1.00
R8830:Arhgef40 UTSW 14 52,241,165 (GRCm39) missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 52,235,072 (GRCm39) missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 52,226,415 (GRCm39) missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 52,235,673 (GRCm39) missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52,241,141 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAATGGCTGTGTAGAAACCC -3'
(R):5'- AGGCTCCTGGTAGAGACAATACC -3'

Sequencing Primer
(F):5'- TGGCTGTGTAGAAACCCCATAC -3'
(R):5'- CCGAGCTATAGACATCTAGACTTTC -3'
Posted On 2015-09-25