Incidental Mutation 'R4596:Slc16a14'
ID 344361
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission 041812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4596 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84929357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 65 (E65D)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422] [ENSMUST00000186980]
AlphaFold Q8K1C7
Predicted Effect probably damaging
Transcript: ENSMUST00000027422
AA Change: E65D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: E65D

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186980
AA Change: E65D

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140314
Gene: ENSMUSG00000026220
AA Change: E65D

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,805 K429E probably benign Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adad1 T C 3: 37,065,192 S141P probably damaging Het
Anapc4 T C 5: 52,841,718 V124A probably benign Het
Anxa6 G T 11: 54,994,583 probably null Het
Arhgef40 T C 14: 51,987,224 probably null Het
Asz1 A T 6: 18,103,593 I116K possibly damaging Het
Bcam T C 7: 19,764,157 N314D probably damaging Het
Cfi T C 3: 129,868,500 V376A probably damaging Het
Cipc A G 12: 86,961,954 T196A probably benign Het
Cnksr1 A G 4: 134,233,878 V225A possibly damaging Het
Col4a4 G A 1: 82,471,219 P1217S unknown Het
Dync2h1 C T 9: 6,992,595 D3996N probably benign Het
Fasl T C 1: 161,788,269 N6S probably benign Het
Fhod3 A T 18: 25,115,718 Q1318L probably benign Het
Gmps G T 3: 63,993,917 E386* probably null Het
Hspa13 C T 16: 75,758,226 G324D probably benign Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Itgb1bp1 C A 12: 21,272,134 L101F probably damaging Het
Jak3 T A 8: 71,684,631 S779T probably damaging Het
Klhl21 G T 4: 152,012,540 R421L probably benign Het
Mgat4c T C 10: 102,388,561 F212S probably damaging Het
Msl3l2 T A 10: 56,115,645 F155L probably benign Het
Nfat5 A G 8: 107,351,500 K406E possibly damaging Het
Nsd2 A T 5: 33,882,918 H933L probably damaging Het
Olfr1183 A G 2: 88,462,194 T304A probably benign Het
Olfr1497 G A 19: 13,794,900 T237I probably damaging Het
Olfr308 A T 7: 86,321,423 H176Q probably damaging Het
Olfr572 A G 7: 102,928,251 T208A possibly damaging Het
Paxbp1 T C 16: 91,030,547 I467V probably benign Het
Pcdha8 A C 18: 36,993,558 Q364H possibly damaging Het
Prr14l T C 5: 32,829,308 T948A probably benign Het
Ptgfr A T 3: 151,801,793 V311D probably damaging Het
Ptpn13 A G 5: 103,523,692 Y495C probably benign Het
Sec61g A T 11: 16,508,127 S23T probably benign Het
Sema3a G T 5: 13,570,157 V458F probably damaging Het
Slc35f6 T C 5: 30,648,062 M14T probably damaging Het
Slc4a10 A T 2: 62,296,858 I882F probably damaging Het
Sox17 C A 1: 4,492,637 E48D possibly damaging Het
Thbs1 A T 2: 118,114,755 I270F possibly damaging Het
Tia1 A G 6: 86,420,407 I121V probably benign Het
Trim30d A T 7: 104,472,526 H337Q probably benign Het
Tvp23b G A 11: 62,883,718 A63T probably benign Het
U2surp C T 9: 95,485,628 V437I probably damaging Het
Ube2i T C 17: 25,265,324 probably benign Het
Vmn1r62 A G 7: 5,675,307 probably benign Het
Wdr3 G A 3: 100,152,867 S310F possibly damaging Het
Wdr72 A T 9: 74,151,605 M327L probably benign Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATACCCAGTACCTAATGTTTCAGG -3'
(R):5'- ACTGCGTGTGTTTCAGAAAACC -3'

Sequencing Primer
(F):5'- CCAGTACCTAATGTTTCAGGAATGTG -3'
(R):5'- CATGAAGATATCGGGTATGACCTTG -3'
Posted On 2015-09-25