Incidental Mutation 'R7914:Arhgef40'
ID 647972
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor (GEF) 40
Synonyms E130112L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R7914 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 51984719-52006251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51987575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 59 (L59P)
Ref Sequence ENSEMBL: ENSMUSP00000091331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
AlphaFold Q3UPH7
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: L59P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: L59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: L59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182193
AA Change: L59P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect probably damaging
Transcript: ENSMUST00000182760
AA Change: L59P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182905
AA Change: L59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: L59P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183208
AA Change: L59P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562
AA Change: L59P

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,592,676 V12F probably benign Het
4932438A13Rik A T 3: 36,946,283 N1204Y probably benign Het
Adnp2 T A 18: 80,130,841 R118W probably damaging Het
Apaf1 G A 10: 91,060,233 R337C probably damaging Het
B020011L13Rik A G 1: 117,801,432 E223G probably benign Het
Bcl6 T C 16: 23,970,011 R536G possibly damaging Het
Catsperg1 T C 7: 29,195,426 E582G probably benign Het
Ccdc136 A G 6: 29,419,307 N942S probably damaging Het
Ccdc81 A C 7: 89,875,780 M531R possibly damaging Het
Cep78 T C 19: 15,976,308 E283G probably benign Het
Cnot1 ACG A 8: 95,745,647 probably null Het
E230025N22Rik C A 18: 36,695,552 R24S possibly damaging Het
Epb41l1 T A 2: 156,522,208 M879K probably benign Het
Fam135a T C 1: 24,026,679 Y1226C probably damaging Het
Fam212a T C 9: 107,985,562 probably benign Het
Fbxo11 T C 17: 88,012,603 E151G Het
Herc6 A G 6: 57,607,121 T322A probably benign Het
Kalrn T A 16: 34,028,752 Q2110L probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc19 T A 4: 94,638,300 H340L probably damaging Het
Mkks A T 2: 136,880,956 F94I probably damaging Het
Pcdhga3 T A 18: 37,674,960 F155L probably benign Het
Pdlim1 T A 19: 40,252,001 I53F probably damaging Het
Pttg1 A T 11: 43,425,594 L26Q probably benign Het
Rasa4 T A 5: 136,101,656 probably benign Het
Rsbn1l A G 5: 20,905,898 S481P probably damaging Het
Sae1 C A 7: 16,387,723 G10C unknown Het
Samd15 T C 12: 87,201,785 S415P probably damaging Het
Scn7a T A 2: 66,699,950 I684F probably damaging Het
Sec23b T A 2: 144,564,645 M120K probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Slf2 T A 19: 44,959,060 M821K possibly damaging Het
Suv39h2 G A 2: 3,464,416 R301* probably null Het
Tgfbi A G 13: 56,629,689 T329A probably damaging Het
Tmprss12 T C 15: 100,285,230 F151S probably damaging Het
Ttn T C 2: 76,917,181 D4508G probably benign Het
Tyk2 C A 9: 21,121,555 C304F probably benign Het
Vmn1r121 T A 7: 21,097,664 T284S probably benign Het
Vmn2r117 A G 17: 23,460,126 I708T possibly damaging Het
Vmn2r2 A T 3: 64,134,105 D396E probably benign Het
Zfc3h1 A G 10: 115,403,157 probably null Het
Zic4 T G 9: 91,384,128 V275G probably damaging Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 51991797 missense unknown
R7857:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
R8060:Arhgef40 UTSW 14 51984995 splice site probably benign
R8144:Arhgef40 UTSW 14 51998175 missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 51988769 missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 51989400 missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52000957 missense probably damaging 1.00
R8830:Arhgef40 UTSW 14 52003708 missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 51997615 missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 51988958 missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCCATGCTTAGAAAGTC -3'
(R):5'- TGCCCTTGCAGATTGTTAGTATC -3'

Sequencing Primer
(F):5'- GTATTGTCTCTACCAGGAGCCTGAAC -3'
(R):5'- TCTGAGTAGTCACAATCATGGG -3'
Posted On 2020-09-15