Mutagenetix > Incidental Mutation

Incidental Mutation 'R4606:Rnd2'

346033

Institutional Source

Beutler Lab

Gene Symbol

Rnd2

Ensembl Gene

ENSMUSG00000001313

Gene Name

Rho family GTPase 2

Synonyms

Arhn, Rohn

MMRRC Submission

041817-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4606 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101464999-101471853 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101468999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 57 (L57F)

Ref Sequence

ENSEMBL: ENSMUSP00000001347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]

AlphaFold

Q9QYM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

Domain	Start	End	E-Value	Type
RHO	10	184	5.22e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040430

SMART Domains

Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	41	60	N/A	INTRINSIC
Pfam:ADH_N	89	157	8.8e-11	PFAM
Pfam:ADH_zinc_N	213	355	2.1e-21	PFAM
Pfam:ADH_zinc_N_2	245	398	6.9e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134980

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153185

Meta Mutation Damage Score

0.1630

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	T	8: 79,210,745	W178R	probably benign	Het
Abcb5	T	C	12: 118,932,610		probably null	Het
Akr1b3	C	A	6: 34,306,664		probably benign	Het
Arid1a	A	G	4: 133,687,323	F1199S	unknown	Het
Atp4b	A	G	8: 13,389,998	F116S	probably damaging	Het
Atp6v1b1	T	C	6: 83,752,461	S127P	probably damaging	Het
Blk	C	T	14: 63,374,203	V428I	probably benign	Het
C87414	A	T	5: 93,636,602	D137E	probably damaging	Het
Ccser1	T	C	6: 61,311,584	S244P	probably damaging	Het
Ceacam1	T	A	7: 25,474,526	I235F	probably damaging	Het
Cyp2g1	T	A	7: 26,814,154	Y173N	possibly damaging	Het
Ddr2	T	A	1: 170,001,852	I278F	probably benign	Het
Degs1	T	C	1: 182,276,823	D299G	probably damaging	Het
Dip2b	G	A	15: 100,215,329	V1542I	possibly damaging	Het
Dmxl1	T	A	18: 49,962,181	S2942R	probably damaging	Het
Dpf1	T	A	7: 29,316,590		probably benign	Het
Ephb6	A	G	6: 41,616,574	Y518C	probably benign	Het
Eps15l1	A	T	8: 72,373,916	F606I	possibly damaging	Het
Extl1	A	G	4: 134,371,379	S114P	probably damaging	Het
Extl1	A	C	4: 134,371,380	D113E	probably benign	Het
Fat1	T	C	8: 44,950,683	V157A	possibly damaging	Het
Fcho1	A	T	8: 71,712,480	D444E	probably benign	Het
Fgd3	T	A	13: 49,296,560	D71V	probably damaging	Het
Fgd5	T	A	6: 91,988,209	D316E	possibly damaging	Het
Gys2	A	T	6: 142,454,484	F334I	possibly damaging	Het
Ik	G	T	18: 36,753,555	R360L	possibly damaging	Het
Kazn	A	C	4: 142,118,288		probably null	Het
Kmt2d	A	T	15: 98,839,716		probably benign	Het
Krr1	T	C	10: 111,975,677		probably benign	Het
Krt83	C	T	15: 101,487,049	E389K	probably benign	Het
Lrrc4c	T	C	2: 97,630,313	V428A	probably benign	Het
Lvrn	C	A	18: 46,864,765	T260K	possibly damaging	Het
Mcc	C	T	18: 44,468,421	E614K	probably damaging	Het
Msrb3	A	T	10: 120,849,997	V81D	probably damaging	Het
Muc19	C	T	15: 91,934,383		noncoding transcript	Het
Myadm	T	A	7: 3,297,400	L226*	probably null	Het
Myof	C	T	19: 37,967,099	V526M	probably damaging	Het
Nckap5l	A	G	15: 99,429,323		probably benign	Het
Olfr1010	T	A	2: 85,753,940		probably benign	Het
Olfr1260	C	A	2: 89,978,006	A76D	possibly damaging	Het
Olfr1270	G	T	2: 90,148,816		probably benign	Het
Olfr398	A	G	11: 73,983,892	S239P	probably damaging	Het
Pars2	T	C	4: 106,654,050	V307A	probably benign	Het
Pcdhb1	T	G	18: 37,265,528	Y177*	probably null	Het
Pcdhb4	T	A	18: 37,308,652	D338E	probably damaging	Het
Pik3r2	G	A	8: 70,772,136	R199*	probably null	Het
Pla2g4f	C	T	2: 120,313,986	R24Q	probably benign	Het
Pnma2	T	C	14: 66,916,232	I35T	probably benign	Het
Podn	C	A	4: 108,017,867	A568S	probably benign	Het
Pou3f1	A	T	4: 124,658,836	E377V	probably damaging	Het
Ppfia1	T	C	7: 144,485,192	D494G	probably damaging	Het
Ptpn9	A	T	9: 57,022,211	T71S	possibly damaging	Het
Ptprz1	C	T	6: 23,001,487	P1192L	possibly damaging	Het
Rnf217	T	A	10: 31,517,476	K370*	probably null	Het
Rpap2	G	A	5: 107,601,795	V62I	possibly damaging	Het
Scaper	A	T	9: 55,655,903		probably null	Het
Sos2	T	C	12: 69,614,606		probably benign	Het
Sptbn5	C	T	2: 120,067,446		probably null	Het
Sumo1	A	G	1: 59,644,509		probably benign	Het
Syne2	C	A	12: 75,989,253	N3771K	probably damaging	Het
Tbx18	T	C	9: 87,730,769	I26V	possibly damaging	Het
Trpm3	T	A	19: 22,978,624	M1140K	probably benign	Het
Usp29	G	A	7: 6,963,357		probably null	Het
Wdr7	C	T	18: 63,779,945	Q946*	probably null	Het
Ythdf1	T	C	2: 180,912,182	D46G	probably damaging	Het
Zfp217	T	C	2: 170,119,750	N219S	possibly damaging	Het
Zkscan3	A	G	13: 21,393,783	I256T	probably benign	Het

Other mutations in Rnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Rnd2	APN	11	101471191	missense	possibly damaging	0.81
IGL01964:Rnd2	APN	11	101470806	splice site	probably null
Atkins	UTSW	11	101468999	missense	probably damaging	1.00
R1581:Rnd2	UTSW	11	101471196	missense	probably benign
R4797:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4824:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4825:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4931:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5005:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5078:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5079:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5402:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5405:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5497:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5498:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5501:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5534:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5619:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5666:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5669:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5670:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5671:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5786:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5788:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5844:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5845:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5857:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5989:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5991:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5992:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6018:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6019:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6020:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6122:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6144:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6148:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6208:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6209:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6226:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6230:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6332:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6333:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6335:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6491:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6541:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6605:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6606:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6607:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6677:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6678:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6726:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6796:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6797:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R8415:Rnd2	UTSW	11	101471185	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTCTGTCTAGGGACTGAGCTG -3'
(R):5'- GCCGATATTAGACTTCCTACGTGG -3'

Sequencing Primer
(F):5'- TCTAGGGACTGAGCTGGACCG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'

Posted On

2015-09-25