Incidental Mutation 'R4642:Pyroxd1'
ID351678
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
MMRRC Submission 041904-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4642 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142345654-142363257 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 142354741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 199 (S199*)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041852
AA Change: S199*
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: S199*

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153912
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 T C 8: 79,689,353 T387A probably damaging Het
Acaca A T 11: 84,280,461 T3S probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Cacna1g A G 11: 94,418,094 I1631T probably damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Ccbe1 A T 18: 66,291,583 probably benign Het
Ccdc184 T G 15: 98,168,656 V114G probably benign Het
Cpxm2 C T 7: 132,070,881 R313H probably benign Het
Crebrf G T 17: 26,743,061 E377D probably benign Het
Dcstamp T C 15: 39,754,722 F176L probably benign Het
Dnah2 T C 11: 69,496,559 D947G probably benign Het
Erbb4 A G 1: 68,250,632 I750T probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm16391 T G 17: 76,284,831 noncoding transcript Het
Gm973 A T 1: 59,558,114 E434D probably damaging Het
Hdac7 T C 15: 97,806,516 E491G probably damaging Het
Hyal5 A G 6: 24,876,622 N165D probably benign Het
Ly86 A T 13: 37,376,901 R79S possibly damaging Het
Mapk7 A G 11: 61,490,901 I13T probably damaging Het
Medag T A 5: 149,411,979 M1K probably null Het
Myh9 T C 15: 77,761,951 D1944G probably benign Het
Nadk2 T C 15: 9,092,721 W206R possibly damaging Het
Olfr830 T A 9: 18,876,167 M280K probably damaging Het
Pcdhb11 T A 18: 37,421,968 F117Y probably benign Het
Pdzd8 C T 19: 59,305,230 E396K probably damaging Het
Piezo1 T A 8: 122,495,454 Y541F probably damaging Het
Polr3h T C 15: 81,922,466 I51V probably benign Het
Prune2 T C 19: 17,020,655 probably null Het
Rars2 T G 4: 34,656,229 V461G probably damaging Het
Rasgrp3 T C 17: 75,498,448 C145R possibly damaging Het
Ryr1 T C 7: 29,086,038 T1743A possibly damaging Het
Sac3d1 G A 19: 6,116,404 A325V possibly damaging Het
Shank1 A T 7: 44,313,141 D93V unknown Het
Smg1 T C 7: 118,154,264 probably benign Het
Tbl1xr1 A T 3: 22,188,420 N38I probably damaging Het
Ufc1 A G 1: 171,289,894 I82T probably benign Het
Uggt2 A T 14: 119,034,935 M434K probably benign Het
Unc80 G A 1: 66,671,714 probably null Het
Zan T A 5: 137,464,188 T910S unknown Het
Zfp64 A G 2: 168,934,931 C256R probably benign Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R1319:Pyroxd1 UTSW 6 142359148 missense probably benign 0.33
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4638:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4643:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5359:Pyroxd1 UTSW 6 142361991 missense probably damaging 1.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7056:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGCCCCTAAAGTGAGCTC -3'
(R):5'- AGCCCTATGTATTTTCTAATCTGAACA -3'

Sequencing Primer
(F):5'- GCACATAGCAGGCGTTCAG -3'
(R):5'- ACATTCCTGCCTCCTGAAT -3'
Posted On2015-10-08