Mutagenetix > Incidental Mutation

Incidental Mutation 'R0552:Pyroxd1'

45234

Institutional Source

Beutler Lab

Gene Symbol

Pyroxd1

Ensembl Gene

ENSMUSG00000041671

Gene Name

pyridine nucleotide-disulphide oxidoreductase domain 1

Synonyms

MMRRC Submission

038744-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0552 (G1)

Quality Score

149

Status

Not validated

Chromosome

Chromosomal Location

142345654-142363257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 142345737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2 (E2G)

Ref Sequence

ENSEMBL: ENSMUSP00000036394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852]

AlphaFold

Q3TMV7

Predicted Effect

probably benign
Transcript: ENSMUST00000032370

SMART Domains

Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	2.5e-27	SMART
HELICc	328	409	2.2e-26	SMART
Pfam:RQC	488	592	5.5e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000041852
AA Change: E2G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: E2G

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	8	234	2.2e-18	PFAM
Pfam:Pyr_redox_2	266	381	4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123289

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204971

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam9	A	T	8: 24,963,010	N760K	probably benign	Het
Akr1b10	A	G	6: 34,392,985	T216A	possibly damaging	Het
Arsj	A	G	3: 126,439,344	R580G	probably benign	Het
C9	A	T	15: 6,445,437	I26F	probably damaging	Het
Cacna2d1	A	G	5: 16,328,043	E578G	probably damaging	Het
Clca4b	C	T	3: 144,916,775	V510I	probably benign	Het
Dab2	C	T	15: 6,435,414	T561I	possibly damaging	Het
E430018J23Rik	A	T	7: 127,392,332	I161N	possibly damaging	Het
Gm4737	T	A	16: 46,154,592	T141S	probably benign	Het
Golga5	A	T	12: 102,484,493	E12D	possibly damaging	Het
Hsd17b12	A	T	2: 94,043,935	F208I	probably damaging	Het
Inf2	A	G	12: 112,612,574		probably benign	Het
Kcnh3	T	A	15: 99,229,456	W378R	probably damaging	Het
Klhdc8b	G	C	9: 108,449,223	R158G	possibly damaging	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Lcn3	T	C	2: 25,766,409		probably null	Het
Mppe1	A	G	18: 67,237,348		probably null	Het
Muc20	G	A	16: 32,793,930	A359V	probably damaging	Het
Myh14	T	C	7: 44,613,681	D1765G	probably damaging	Het
Olfr1257	C	T	2: 89,880,891	Q22*	probably null	Het
Olfr418	T	C	1: 173,270,805	M210T	probably benign	Het
Olfr482	A	G	7: 108,094,778	M264T	probably benign	Het
Pbrm1	T	A	14: 31,035,959	L182Q	probably damaging	Het
Pde8a	A	G	7: 81,317,347	N412S	probably benign	Het
Phyh	A	G	2: 4,936,101	T271A	probably damaging	Het
Pkhd1l1	T	C	15: 44,489,546	S258P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapa1	G	T	12: 55,676,765	Q2115K	probably benign	Het
Rufy3	A	G	5: 88,584,270	E44G	possibly damaging	Het
Slit2	A	T	5: 48,238,379	N712I	probably damaging	Het
Sptbn1	A	G	11: 30,145,985	M303T	possibly damaging	Het
Ssbp4	A	G	8: 70,599,859	I154T	probably benign	Het
Syne2	A	G	12: 75,931,004	K1409E	probably benign	Het
Tfap2b	T	C	1: 19,234,225	Y420H	probably damaging	Het
Tlr5	A	G	1: 182,975,696		probably null	Het
Tmprss15	C	T	16: 79,024,749		probably null	Het
Tns1	A	T	1: 73,920,563	I418N	probably damaging	Het
Txlna	A	T	4: 129,629,191	V452D	probably benign	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zfp563	A	T	17: 33,104,685	S85C	possibly damaging	Het

Other mutations in Pyroxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Pyroxd1	APN	6	142361758	missense	probably damaging	0.96
IGL01720:Pyroxd1	APN	6	142351058	splice site	probably benign
IGL02139:Pyroxd1	APN	6	142354731	missense	probably benign
IGL02930:Pyroxd1	APN	6	142359052	missense	probably damaging	1.00
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0329:Pyroxd1	UTSW	6	142361976	missense	probably benign	0.37
R0505:Pyroxd1	UTSW	6	142353562	missense	possibly damaging	0.55
R1073:Pyroxd1	UTSW	6	142348644	critical splice donor site	probably null
R1319:Pyroxd1	UTSW	6	142359148	missense	probably benign	0.33
R2200:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R4638:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4639:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4640:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4641:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4642:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4643:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4645:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4687:Pyroxd1	UTSW	6	142361868	missense	probably benign	0.00
R5359:Pyroxd1	UTSW	6	142361991	missense	probably damaging	1.00
R5688:Pyroxd1	UTSW	6	142353540	missense	probably damaging	1.00
R6208:Pyroxd1	UTSW	6	142357456	missense	probably benign	0.00
R6295:Pyroxd1	UTSW	6	142354753	missense	probably benign	0.00
R7056:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R7445:Pyroxd1	UTSW	6	142358501	missense	probably benign	0.03
R8925:Pyroxd1	UTSW	6	142354711	missense	probably damaging	1.00
R8927:Pyroxd1	UTSW	6	142354711	missense	probably damaging	1.00
R8987:Pyroxd1	UTSW	6	142356525	missense
R9555:Pyroxd1	UTSW	6	142354695	missense	possibly damaging	0.65
V1662:Pyroxd1	UTSW	6	142358443	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTCTGCCTCCAGATTTTCAAACGC -3'
(R):5'- TTCTGTCCAAACGCCAAGGTCTC -3'

Sequencing Primer
(F):5'- AGATTTTCAAACGCAAAACACG -3'
(R):5'- AGGCACTGTCTACTCCTGG -3'

Posted On

2013-06-11