Incidental Mutation 'R4656:Ces1b'
ID352441
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 041916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4656 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93057414 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 488 (E488Q)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably damaging
Transcript: ENSMUST00000109582
AA Change: E488Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: E488Q

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,981,616 R59H probably benign Het
2310003L06Rik G A 5: 87,964,675 probably benign Het
4931406B18Rik T A 7: 43,501,141 H69L probably benign Het
Ace2 T C X: 164,153,114 S84P probably benign Het
Adgb A C 10: 10,405,306 N656K probably damaging Het
Ago3 G T 4: 126,363,752 Y495* probably null Het
Ahnak G A 19: 9,004,855 V1168M possibly damaging Het
Armc10 A G 5: 21,661,550 R271G probably benign Het
Atp4a T G 7: 30,719,948 probably benign Het
C87499 T C 4: 88,629,965 T68A probably benign Het
Casp1 C T 9: 5,304,324 P333S probably damaging Het
Ceacam9 C T 7: 16,723,649 A34V probably benign Het
Ces2h A T 8: 105,014,639 T88S possibly damaging Het
Col2a1 C T 15: 97,976,176 G1375D unknown Het
Cyp1a1 T C 9: 57,702,610 F436L probably damaging Het
Dcaf7 T C 11: 106,053,798 V269A probably damaging Het
Disp2 T C 2: 118,790,563 L592P probably damaging Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Egln2 A G 7: 27,159,193 V408A probably benign Het
Gabpb2 A G 3: 95,188,941 L325P probably damaging Het
Gigyf1 C A 5: 137,525,215 Y936* probably null Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gnl2 C T 4: 125,040,997 Q149* probably null Het
Gpr107 C T 2: 31,214,249 T522M probably damaging Het
Grpr T A X: 163,514,996 S351C probably damaging Het
Gsdma T C 11: 98,673,081 L287P probably damaging Het
Herc1 A G 9: 66,394,711 T652A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Irx2 T C 13: 72,631,298 S234P probably damaging Het
Itgal T A 7: 127,322,553 D808E probably damaging Het
Krt13 C A 11: 100,119,363 R264L probably damaging Het
March1 T A 8: 66,386,419 L38I probably benign Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Mif4gd G T 11: 115,608,337 probably benign Het
Mroh9 A T 1: 163,066,024 M194K probably damaging Het
Nhlrc3 A G 3: 53,463,080 S22P probably damaging Het
Nipal2 A T 15: 34,577,568 probably null Het
Nr1h4 A G 10: 89,498,253 S78P probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr390 A T 11: 73,787,511 D191V probably damaging Het
Olfr607 C T 7: 103,460,488 R235Q probably benign Het
Olfr908 A T 9: 38,516,556 N175Y probably damaging Het
Pdzd2 A G 15: 12,385,711 V991A probably benign Het
Pex1 G A 5: 3,604,880 probably null Het
Plch1 G T 3: 63,704,177 A859E probably damaging Het
Ranbp2 A G 10: 58,453,422 K84R possibly damaging Het
Rbm14 T C 19: 4,811,435 Y25C probably damaging Het
Rmi2 A G 16: 10,835,322 D78G probably damaging Het
Serpina3k C A 12: 104,345,273 T370K probably damaging Het
Shc2 A T 10: 79,621,169 L538M probably damaging Het
Skint1 A G 4: 112,021,477 K202R probably damaging Het
Slc22a29 C A 19: 8,218,300 S125I possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco4c1 A T 1: 96,841,245 D297E probably benign Het
Slco6d1 T C 1: 98,423,203 F136S probably benign Het
Smg1 A T 7: 118,212,951 V39E probably benign Het
Spns1 G T 7: 126,374,302 probably benign Het
Spsb1 A G 4: 149,906,410 probably null Het
Sspo T G 6: 48,454,076 I631S possibly damaging Het
Syne2 T C 12: 76,031,373 L4694P probably damaging Het
Taf5l T C 8: 123,998,105 E325G probably benign Het
Tars A T 15: 11,394,264 S96T probably damaging Het
Tdrd12 T C 7: 35,485,254 K745E probably damaging Het
Tenm3 A G 8: 48,293,726 Y1015H probably damaging Het
Trpv3 T A 11: 73,295,414 M677K probably damaging Het
Txlnb A T 10: 17,815,276 K191N probably damaging Het
Ubr1 A G 2: 120,926,013 V711A probably benign Het
Uqcrb T C 13: 66,901,539 T41A probably benign Het
Usp6nl A G 2: 6,441,162 Y627C probably damaging Het
Vezf1 A G 11: 88,074,667 D245G probably damaging Het
Vmn2r66 A G 7: 85,011,996 W9R possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Wrn A T 8: 33,335,991 probably null Het
Zfy1 T G Y: 729,626 T339P unknown Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAGGAATGGCCCATCTGACTC -3'
(R):5'- TTGACCCCTGAACATGCAC -3'

Sequencing Primer
(F):5'- GAATGGCCCATCTGACTCTAGAG -3'
(R):5'- CACAGTGATTAGCCAGGGTCTTC -3'
Posted On2015-10-08