Incidental Mutation 'R4761:Ehbp1l1'
ID356916
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
Synonyms
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5719847 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 476 (P476L)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: P476L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: P476L

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5719176 missense possibly damaging 0.70
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5708670 missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6329:Ehbp1l1 UTSW 19 5718767 missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5718757 missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5717075 missense probably damaging 1.00
R8324:Ehbp1l1 UTSW 19 5719998 missense possibly damaging 0.86
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGTCCCTATAACCTCCCATGG -3'
(R):5'- TGCTGAGCACAAGTCAAAGG -3'

Sequencing Primer
(F):5'- CCATCTGATGGGACTGTCTGAAC -3'
(R):5'- TGAGCACAAGTCAAAGGTTCAAC -3'
Posted On2015-11-11