Incidental Mutation 'R4725:Cep192'
ID358433
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Namecentrosomal protein 192
Synonyms4631422C13Rik, D430014P18Rik
MMRRC Submission 041960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4725 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location67800107-67885170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67816766 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 307 (Q307P)
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
Predicted Effect probably benign
Transcript: ENSMUST00000025425
AA Change: Q307P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: Q307P

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225077
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,703 probably benign Het
Adamts20 T C 15: 94,351,762 E458G probably damaging Het
Adgrl3 T C 5: 81,766,205 I1220T possibly damaging Het
Aldh1a1 T A 19: 20,640,081 M459K probably benign Het
Arntl C A 7: 113,304,359 P454Q possibly damaging Het
Camta1 A G 4: 151,148,496 V240A probably benign Het
Ccdc88b C T 19: 6,857,113 G149R probably damaging Het
Ceacam5 T C 7: 17,760,677 V870A probably benign Het
Cep63 T C 9: 102,590,556 probably benign Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp1 G A 1: 74,394,664 V135I possibly damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dchs1 C G 7: 105,765,552 G761A probably damaging Het
Dennd5b A G 6: 149,044,779 Y445H probably damaging Het
Dock1 T A 7: 134,745,014 L225* probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Dysf A T 6: 84,097,756 N527I probably damaging Het
Erbb2 A G 11: 98,425,144 T358A possibly damaging Het
Fhad1 A T 4: 141,928,378 probably null Het
Ganc T C 2: 120,435,273 I434T probably damaging Het
Gm15448 A C 7: 3,821,548 S611A probably benign Het
Gm5830 T A 1: 78,967,832 noncoding transcript Het
Gm6096 G T 7: 34,251,059 E8* probably null Het
Gne A G 4: 44,066,806 F63S probably benign Het
Gpat2 T C 2: 127,431,982 V315A possibly damaging Het
Gpr33 A G 12: 52,024,109 L49P probably damaging Het
Heatr1 C T 13: 12,424,662 Q1374* probably null Het
Hivep1 A G 13: 42,163,411 I2032V probably benign Het
Igkv2-112 A C 6: 68,220,466 I40L probably benign Het
Kcnab3 A G 11: 69,330,468 N204D probably benign Het
Kcnj10 T A 1: 172,369,159 F80Y probably damaging Het
Lcmt2 C G 2: 121,139,430 V171L probably benign Het
Loxhd1 T A 18: 77,395,457 Y1245N probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Mast1 A G 8: 84,929,006 S170P possibly damaging Het
Mroh4 A G 15: 74,616,107 L322P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nudcd3 A T 11: 6,193,475 V1D probably damaging Het
Pah T A 10: 87,554,376 L25Q probably damaging Het
Pik3cg A T 12: 32,193,597 probably null Het
Plekha6 C A 1: 133,283,320 S625Y probably damaging Het
Rtn4 T A 11: 29,708,362 S839T probably damaging Het
Rusc1 A G 3: 89,091,429 S349P possibly damaging Het
Samsn1 A T 16: 75,945,329 noncoding transcript Het
Scimp A G 11: 70,800,713 V30A probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sgip1 A G 4: 102,966,222 D680G probably damaging Het
Slc44a2 G A 9: 21,348,395 V613M probably damaging Het
Smpdl3b T C 4: 132,745,178 T95A probably damaging Het
Spag6l A T 16: 16,792,531 L85H probably damaging Het
Sucla2 T A 14: 73,568,989 Y167N possibly damaging Het
Svop G T 5: 114,065,485 probably benign Het
Tnxb A T 17: 34,699,067 D2318V probably damaging Het
Trbv14 A G 6: 41,135,398 D43G probably benign Het
Ubn2 A G 6: 38,522,305 probably benign Het
Ufsp1 T C 5: 137,295,307 I173T probably damaging Het
Zbtb40 A G 4: 137,018,761 probably benign Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0281:Cep192 UTSW 18 67828482 splice site probably benign
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2898:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4591:Cep192 UTSW 18 67834968 missense probably damaging 0.99
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67834713 missense probably damaging 1.00
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R6861:Cep192 UTSW 18 67841628 missense probably benign 0.43
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATCCCGTATGATGCTTG -3'
(R):5'- GACAGCACACGTTTAAAGCC -3'

Sequencing Primer
(F):5'- ATCCCGTATGATGCTTGTTTTC -3'
(R):5'- TCAGAGGTCAACAATTTTCTTCTG -3'
Posted On2015-11-11