Mutagenetix > Incidental Mutation

Incidental Mutation 'R1978:Cep192'

222083

Institutional Source

Beutler Lab

Gene Symbol

Cep192

Ensembl Gene

ENSMUSG00000024542

Gene Name

centrosomal protein 192

Synonyms

4631422C13Rik, D430014P18Rik

MMRRC Submission

039991-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1978 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67800107-67885170 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 67803158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025425]

AlphaFold

E9Q4Y4

Predicted Effect

probably null
Transcript: ENSMUST00000025425

SMART Domains

Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542

Domain	Start	End	E-Value	Type
low complexity region	70	84	N/A	INTRINSIC
low complexity region	195	217	N/A	INTRINSIC
low complexity region	975	991	N/A	INTRINSIC
low complexity region	1189	1204	N/A	INTRINSIC
low complexity region	2051	2069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225077

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,537	C205*	probably null	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4921539E11Rik	T	A	4: 103,270,764	T55S	possibly damaging	Het
Akap12	A	G	10: 4,313,855	D88G	probably benign	Het
Ankrd53	C	A	6: 83,763,203	F84L	probably damaging	Het
Apol7b	A	C	15: 77,423,339	F319V	probably damaging	Het
Bsn	A	G	9: 108,114,549	S1335P	probably benign	Het
Cfap57	A	G	4: 118,593,132	S598P	probably benign	Het
Commd8	T	C	5: 72,165,499	H25R	probably damaging	Het
Crisp4	T	C	1: 18,128,665	I143V	probably benign	Het
Cyp4a12b	A	T	4: 115,438,145	T483S	probably benign	Het
Dbx2	C	T	15: 95,632,353	M244I	probably damaging	Het
Dnah6	T	G	6: 73,121,970	H1982P	possibly damaging	Het
Fam220a	C	A	5: 143,563,127	P98Q	probably damaging	Het
Ggnbp1	A	G	17: 27,029,543	K29E	possibly damaging	Het
Gm14569	A	C	X: 36,432,128	M976R	probably benign	Het
Gm9573	T	A	17: 35,622,965		probably benign	Het
Hck	G	T	2: 153,129,856	W112C	probably damaging	Het
Heatr5a	A	T	12: 51,939,658	S591T	possibly damaging	Het
Hhat	A	G	1: 192,717,107	S242P	probably benign	Het
Hnrnpll	A	G	17: 80,044,518	S333P	probably benign	Het
Hoxc6	T	C	15: 103,010,007		probably null	Het
Inpp5j	G	A	11: 3,502,150	P367S	probably damaging	Het
Lamc2	A	G	1: 153,133,597		probably null	Het
Loxhd1	T	A	18: 77,321,642	I194N	possibly damaging	Het
Miga1	CCAGGGCAG	CCAG	3: 152,335,304		probably null	Het
Mkln1	C	T	6: 31,490,530	Q60*	probably null	Het
Mybph	C	A	1: 134,196,996	H185N	probably benign	Het
Myo1g	T	C	11: 6,520,829	D9G	possibly damaging	Het
Myo6	A	T	9: 80,228,925	D110V	probably damaging	Het
Ncoa7	A	G	10: 30,691,299	V412A	probably benign	Het
Neb	T	C	2: 52,287,345	K1328R	probably damaging	Het
Olfm5	T	A	7: 104,164,741	Q22L	unknown	Het
Olfr1106	C	T	2: 87,048,835	V134M	possibly damaging	Het
Olfr1328	A	T	4: 118,934,184	Y221*	probably null	Het
Olfr1355	A	G	10: 78,879,280	Y36C	probably damaging	Het
Olfr1414	C	A	1: 92,511,777	G84C	probably damaging	Het
Olfr1423	T	C	19: 12,036,341	T134A	probably benign	Het
Olfr414	T	A	1: 174,431,091	I221N	probably damaging	Het
P3h1	A	T	4: 119,247,976	Q717L	probably null	Het
Pclo	T	C	5: 14,713,795	I4094T	unknown	Het
Pfdn6	G	A	17: 33,939,077	R73W	probably benign	Het
Phyhipl	A	C	10: 70,559,761	M205R	possibly damaging	Het
Pitpnm1	C	T	19: 4,107,973		probably null	Het
Plcg1	A	G	2: 160,752,578		probably null	Het
Pnldc1	A	G	17: 12,906,505	S81P	possibly damaging	Het
Pno1	T	C	11: 17,204,519	I221V	possibly damaging	Het
Porcn	A	G	X: 8,204,301	V75A	probably damaging	Het
Prkcg	T	A	7: 3,305,346	C69S	probably damaging	Het
Rbbp6	G	T	7: 122,999,488		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scly	A	G	1: 91,320,169	D413G	probably damaging	Het
Scn11a	G	A	9: 119,780,795	R996*	probably null	Het
Slc6a13	A	T	6: 121,332,373	D281V	probably damaging	Het
Slfn5	T	C	11: 82,956,616	V109A	probably benign	Het
Smyd1	A	T	6: 71,312,719		probably null	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Stag1	T	G	9: 100,888,086	I603S	probably benign	Het
Svep1	C	A	4: 58,097,292	C1417F	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,351	I392V	probably benign	Het
Tchh	T	C	3: 93,446,799	L1182P	unknown	Het
Tle3	T	A	9: 61,394,633	V108E	probably damaging	Het
Tmem144	T	C	3: 79,825,400		probably null	Het
Tpr	T	G	1: 150,419,907	L894V	possibly damaging	Het
Trappc9	A	T	15: 73,000,025	V472E	probably damaging	Het
Trim38	T	C	13: 23,791,098	V340A	probably damaging	Het
Ttc37	T	C	13: 76,134,815	V752A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn1r12	T	A	6: 57,159,509	I197N	possibly damaging	Het
Vmn1r26	T	C	6: 58,009,126	Y26C	possibly damaging	Het
Vwa3a	A	G	7: 120,758,954	I83V	probably null	Het
Xirp1	C	T	9: 120,018,591	E409K	probably benign	Het
Zc3h14	T	G	12: 98,763,922	I46R	probably damaging	Het
Zfp976	A	G	7: 42,613,841	C191R	probably damaging	Het

Other mutations in Cep192

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Cep192	APN	18	67820336	missense	probably damaging	1.00
IGL00163:Cep192	APN	18	67880800	missense	possibly damaging	0.61
IGL00509:Cep192	APN	18	67858868	missense	possibly damaging	0.78
IGL01012:Cep192	APN	18	67812406	missense	possibly damaging	0.95
IGL01143:Cep192	APN	18	67804375	missense	probably damaging	0.97
IGL01302:Cep192	APN	18	67858903	missense	probably benign	0.03
IGL01653:Cep192	APN	18	67852972	missense	possibly damaging	0.57
IGL02202:Cep192	APN	18	67803137	missense	possibly damaging	0.83
IGL02448:Cep192	APN	18	67869447	missense	probably benign	0.25
IGL02494:Cep192	APN	18	67804383	missense	probably benign	0.00
IGL02574:Cep192	APN	18	67841279	missense	probably damaging	0.99
IGL02624:Cep192	APN	18	67880795	missense	probably benign	0.20
IGL02646:Cep192	APN	18	67862477	missense	probably damaging	1.00
IGL02652:Cep192	APN	18	67858850	splice site	probably benign
IGL02684:Cep192	APN	18	67834563	missense	probably damaging	0.99
IGL02977:Cep192	APN	18	67852905	missense	probably damaging	0.97
IGL03000:Cep192	APN	18	67852044	missense	probably damaging	1.00
IGL03133:Cep192	APN	18	67810105	missense	probably benign	0.00
IGL03139:Cep192	APN	18	67828476	critical splice donor site	probably null
IGL03213:Cep192	APN	18	67865637	missense	probably damaging	1.00
IGL03250:Cep192	APN	18	67807355	missense	probably benign	0.01
IGL03259:Cep192	APN	18	67820412	missense	probably damaging	1.00
R0117:Cep192	UTSW	18	67850737	critical splice donor site	probably null
R0180:Cep192	UTSW	18	67835488	missense	probably damaging	1.00
R0281:Cep192	UTSW	18	67828482	splice site	probably benign
R0374:Cep192	UTSW	18	67818883	nonsense	probably null
R0420:Cep192	UTSW	18	67813893	missense	possibly damaging	0.91
R0479:Cep192	UTSW	18	67858018	missense	probably damaging	1.00
R0652:Cep192	UTSW	18	67807265	missense	probably benign	0.04
R1024:Cep192	UTSW	18	67838054	missense	probably benign	0.37
R1382:Cep192	UTSW	18	67856299	missense	possibly damaging	0.74
R1394:Cep192	UTSW	18	67858921	missense	probably damaging	1.00
R1395:Cep192	UTSW	18	67858921	missense	probably damaging	1.00
R1641:Cep192	UTSW	18	67847433	missense	probably damaging	1.00
R1704:Cep192	UTSW	18	67856256	missense	probably damaging	1.00
R1793:Cep192	UTSW	18	67851767	missense	possibly damaging	0.74
R1835:Cep192	UTSW	18	67804424	missense	possibly damaging	0.95
R2164:Cep192	UTSW	18	67820360	missense	probably damaging	0.99
R2180:Cep192	UTSW	18	67824742	missense	possibly damaging	0.82
R2307:Cep192	UTSW	18	67813899	missense	probably benign	0.07
R2442:Cep192	UTSW	18	67824688	missense	possibly damaging	0.89
R2897:Cep192	UTSW	18	67855270	splice site	probably null
R2898:Cep192	UTSW	18	67855270	splice site	probably null
R2901:Cep192	UTSW	18	67869441	missense	possibly damaging	0.94
R3433:Cep192	UTSW	18	67834892	missense	probably benign	0.08
R3620:Cep192	UTSW	18	67829857	missense	probably benign	0.00
R3621:Cep192	UTSW	18	67829857	missense	probably benign	0.00
R3712:Cep192	UTSW	18	67820329	missense	probably benign	0.00
R4559:Cep192	UTSW	18	67871513	missense	probably damaging	1.00
R4590:Cep192	UTSW	18	67816791	nonsense	probably null
R4591:Cep192	UTSW	18	67834968	missense	probably damaging	0.99
R4604:Cep192	UTSW	18	67815922	missense	possibly damaging	0.64
R4627:Cep192	UTSW	18	67812369	missense	probably benign	0.03
R4725:Cep192	UTSW	18	67816766	missense	probably benign
R4738:Cep192	UTSW	18	67884830	nonsense	probably null
R4739:Cep192	UTSW	18	67851732	missense	probably benign	0.02
R4927:Cep192	UTSW	18	67835124	missense	probably benign	0.16
R4948:Cep192	UTSW	18	67816804	missense	probably benign	0.00
R5090:Cep192	UTSW	18	67860546	missense	possibly damaging	0.60
R5105:Cep192	UTSW	18	67866541	missense	probably benign	0.08
R5154:Cep192	UTSW	18	67850684	missense	probably damaging	1.00
R5192:Cep192	UTSW	18	67835004	missense	probably benign	0.03
R5735:Cep192	UTSW	18	67880795	missense	probably benign	0.20
R5812:Cep192	UTSW	18	67851737	missense	possibly damaging	0.49
R5869:Cep192	UTSW	18	67815864	missense	probably benign	0.01
R5981:Cep192	UTSW	18	67860590	missense	probably damaging	1.00
R6131:Cep192	UTSW	18	67837997	missense	possibly damaging	0.65
R6335:Cep192	UTSW	18	67834713	missense	probably damaging	1.00
R6849:Cep192	UTSW	18	67812435	missense	probably benign	0.00
R6861:Cep192	UTSW	18	67841628	missense	probably benign	0.43
R7192:Cep192	UTSW	18	67850528	missense	probably damaging	0.99
R7264:Cep192	UTSW	18	67820355	missense	probably damaging	1.00
R7397:Cep192	UTSW	18	67856197	missense	probably damaging	1.00
R7409:Cep192	UTSW	18	67834803	missense	possibly damaging	0.76
R7696:Cep192	UTSW	18	67820363	missense	probably damaging	1.00
R7756:Cep192	UTSW	18	67856313	missense	possibly damaging	0.92
R7758:Cep192	UTSW	18	67856313	missense	possibly damaging	0.92
R8247:Cep192	UTSW	18	67841117	missense	probably benign	0.02
R8695:Cep192	UTSW	18	67818887	nonsense	probably null
R8865:Cep192	UTSW	18	67834632	missense	probably benign	0.01
R8935:Cep192	UTSW	18	67862472	missense	probably damaging	1.00
R9453:Cep192	UTSW	18	67856283	nonsense	probably null
R9571:Cep192	UTSW	18	67819038	missense	probably damaging	0.98
R9581:Cep192	UTSW	18	67847394	missense	probably damaging	1.00
R9599:Cep192	UTSW	18	67835454	missense	probably benign	0.19
R9779:Cep192	UTSW	18	67835277	missense	probably damaging	1.00
RF003:Cep192	UTSW	18	67837956	missense	probably benign	0.44
X0066:Cep192	UTSW	18	67812449	splice site	probably null
Z1176:Cep192	UTSW	18	67881288	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAAATGCTGTTGTTGTAGTGAGAT -3'
(R):5'- ACACAAACCTAGGGAAGCAG -3'

Sequencing Primer
(F):5'- TTGTTGTAGTGAGATGGAAGATTTC -3'
(R):5'- CACAAACCTAGGGAAGCAGGAAAC -3'

Posted On

2014-08-25