Incidental Mutation 'R0245:Fah'
ID 36172
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0245 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 84585159-84606722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84595498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 222 (H222Q)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000128460]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032865
AA Change: H222Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: H222Q

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128460
SMART Domains Protein: ENSMUSP00000121439
Gene: ENSMUSG00000030630

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 1 48 7.2e-10 PFAM
Pfam:FAA_hydrolase 53 140 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209112
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3612:Fah UTSW 7 84585290 missense probably damaging 0.98
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4386:Fah UTSW 7 84599136 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R6586:Fah UTSW 7 84593260 missense probably benign 0.04
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
R8823:Fah UTSW 7 84605717 missense possibly damaging 0.85
RF002:Fah UTSW 7 84589628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGAGTCAGAAGTCTGCATGG -3'
(R):5'- TTGTCAATCCTCCTGGAATGAGCAC -3'

Sequencing Primer
(F):5'- GGTATCACCCCTGTAGTACTTAG -3'
(R):5'- GTGAGTAGACTTCCCACCTTAGAG -3'
Posted On 2013-05-09