Mutagenetix > Incidental Mutations

Incidental Mutation 'R4774:Rasa1'

367791

Institutional Source

Beutler Lab

Gene Symbol

Rasa1

Ensembl Gene

ENSMUSG00000021549

Gene Name

RAS p21 protein activator 1

Synonyms

p120-rasGAP, Gap

MMRRC Submission

042412-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4774 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85214780-85289130 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 85250502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109552]

AlphaFold

E9PYG6

Predicted Effect

probably benign
Transcript: ENSMUST00000109552

SMART Domains

Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549

Domain	Start	End	E-Value	Type
low complexity region	3	32	N/A	INTRINSIC
low complexity region	37	106	N/A	INTRINSIC
low complexity region	119	142	N/A	INTRINSIC
SH2	170	253	9.44e-29	SMART
SH3	273	331	1.7e-10	SMART
SH2	340	423	7.44e-27	SMART
PH	466	570	5.11e-20	SMART
C2	586	680	6.9e-10	SMART
RasGAP	689	1035	2.77e-156	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153231

Predicted Effect

probably benign
Transcript: ENSMUST00000223598

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (97/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,639,317	I844V	probably damaging	Het
Acnat1	T	A	4: 49,450,784	Y109F	probably benign	Het
Alox12b	T	C	11: 69,163,207	V205A	probably benign	Het
Apopt1	A	G	12: 111,713,389	T33A	possibly damaging	Het
Arl6ip1	G	A	7: 118,121,985	R77C	probably damaging	Het
Atp8b1	A	G	18: 64,533,659	C1156R	possibly damaging	Het
Atp8b3	A	C	10: 80,536,322	N24K	probably damaging	Het
Bdh1	T	C	16: 31,455,136	V209A	possibly damaging	Het
Blm	A	T	7: 80,463,848	C1234S	probably damaging	Het
Caml	A	G	13: 55,631,927	D271G	possibly damaging	Het
Capn11	T	C	17: 45,633,080	D545G	probably benign	Het
Catspere1	T	C	1: 177,937,738		noncoding transcript	Het
Ccdc114	T	A	7: 45,948,380	S571R	probably damaging	Het
Cep128	T	C	12: 91,234,195	E347G	probably damaging	Het
Cngb3	A	G	4: 19,415,713	T408A	possibly damaging	Het
Cog1	G	A	11: 113,657,427	R18Q	possibly damaging	Het
Cps1	T	C	1: 67,220,512	F1338L	probably damaging	Het
Csmd1	T	C	8: 16,009,369	H2122R	probably benign	Het
Ctu2	T	G	8: 122,481,112	S26A	probably benign	Het
Dbf4	G	A	5: 8,403,062		probably benign	Het
Ddx23	A	T	15: 98,647,235	D663E	probably benign	Het
Dpep2	T	C	8: 105,990,756	T123A	possibly damaging	Het
Eed	A	G	7: 89,964,768	I274T	probably damaging	Het
Eif3b	A	G	5: 140,419,500	D47G	probably benign	Het
Epas1	T	C	17: 86,805,758	V124A	probably damaging	Het
Fam129a	A	T	1: 151,715,694	D529V	probably damaging	Het
Fer1l6	T	C	15: 58,577,949	L668P	probably damaging	Het
Fnip2	C	A	3: 79,465,721	E1017*	probably null	Het
Gm43517	A	T	12: 49,389,907		probably benign	Het
Got1	A	G	19: 43,502,906		probably null	Het
H2-Eb2	T	A	17: 34,334,401	V187E	probably damaging	Het
H2-Q1	T	C	17: 35,321,266		probably benign	Het
Hpgd	T	C	8: 56,298,419	V94A	probably damaging	Het
Htra1	T	A	7: 130,985,026	N446K	probably benign	Het
Igkv3-4	T	A	6: 70,672,285	S89R	probably damaging	Het
Immt	C	T	6: 71,852,736	T142I	probably damaging	Het
Itpkb	C	A	1: 180,418,194	P759T	probably damaging	Het
Jmjd1c	G	A	10: 67,224,792	V688I	possibly damaging	Het
Kbtbd13	G	T	9: 65,390,743	R304S	probably benign	Het
Lama5	A	C	2: 180,185,941	L2176R	probably damaging	Het
Lrp1b	G	C	2: 40,661,532	L418V	probably null	Het
Lrrc4b	C	A	7: 44,462,372		probably null	Het
Lyst	A	G	13: 13,740,597	N3292S	probably damaging	Het
Mep1b	A	T	18: 21,086,184	I132F	probably benign	Het
Mettl2	A	G	11: 105,126,610		probably null	Het
Nmd3	T	C	3: 69,745,236	L385S	probably benign	Het
Nol4	T	C	18: 22,912,626	E243G	probably damaging	Het
Olfr1052	A	T	2: 86,298,698	N294I	possibly damaging	Het
Olfr639	A	G	7: 104,012,588	I38T	probably benign	Het
Olfr723	T	A	14: 49,929,269	I92F	probably damaging	Het
Olfr917	A	G	9: 38,665,223	I207T	probably benign	Het
Pcnp	A	G	16: 56,017,159		probably benign	Het
Pla2g6	A	C	15: 79,287,618	C680G	probably damaging	Het
Plekha7	G	T	7: 116,144,943	D661E	probably damaging	Het
Prim1	A	T	10: 128,027,018		probably benign	Het
Psg29	T	A	7: 17,210,535	N323K	probably benign	Het
Ptrh2	G	A	11: 86,690,007	R150H	probably damaging	Het
Rasa3	T	C	8: 13,577,501	D667G	probably benign	Het
Rnase2a	T	C	14: 51,255,744	N55D	probably damaging	Het
Rsf1	GCGGCGGCGGCGGCGGCGGC	GCGGCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,916		probably benign	Het
Sbp	T	A	17: 23,945,244	N133K	probably damaging	Het
Scml4	A	G	10: 42,957,747		probably benign	Het
Sema5b	T	A	16: 35,663,182	N1063K	probably damaging	Het
Serpind1	C	T	16: 17,336,408	T33M	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc15a2	A	T	16: 36,781,695	L80*	probably null	Het
Slc9a3r2	T	C	17: 24,644,899	M1V	probably null	Het
Sorcs3	A	G	19: 48,794,163	D1039G	probably benign	Het
Spon1	A	G	7: 114,039,867	E776G	probably damaging	Het
Tdp1	C	T	12: 99,902,364	A259V	possibly damaging	Het
Tex46	C	A	4: 136,610,680	P61Q	probably benign	Het
Tnr	T	A	1: 159,897,066	L1109Q	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tpra1	G	A	6: 88,910,679		probably benign	Het
Trim43c	A	T	9: 88,847,652	H383L	possibly damaging	Het
Trip6	A	G	5: 137,310,171	C439R	probably damaging	Het
Tsen2	C	T	6: 115,575,933	S398L	possibly damaging	Het
Tubgcp2	T	C	7: 139,996,161	D863G	probably damaging	Het
Ube2d2a	A	G	18: 35,770,445		probably benign	Het
Umad1	T	A	6: 8,427,181	F145I	probably damaging	Het
Unc5c	A	T	3: 141,828,517	E933V	probably damaging	Het
Vmn1r208	A	G	13: 22,772,476	F284L	probably benign	Het
Vmn2r53	T	A	7: 12,600,765	R323*	probably null	Het
Zan	G	A	5: 137,389,019	T4924I	unknown	Het
Zfp597	G	T	16: 3,865,987	Q302K	probably benign	Het

Other mutations in Rasa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Rasa1	APN	13	85288429	missense	probably benign	0.02
IGL01396:Rasa1	APN	13	85258442	missense	probably benign	0.10
IGL01670:Rasa1	APN	13	85225490	missense	probably damaging	0.97
IGL02095:Rasa1	APN	13	85216155	missense	probably benign	0.10
IGL02822:Rasa1	APN	13	85252514	missense	probably damaging	0.97
IGL03126:Rasa1	APN	13	85256396	missense	possibly damaging	0.94
F5770:Rasa1	UTSW	13	85226945	splice site	probably null
PIT4458001:Rasa1	UTSW	13	85227118	missense	possibly damaging	0.91
R1393:Rasa1	UTSW	13	85223522	missense	probably damaging	1.00
R1441:Rasa1	UTSW	13	85252421	splice site	probably null
R1907:Rasa1	UTSW	13	85226572	nonsense	probably null
R4243:Rasa1	UTSW	13	85244195	missense	probably damaging	1.00
R4593:Rasa1	UTSW	13	85238221	splice site	probably null
R4687:Rasa1	UTSW	13	85226635	missense	possibly damaging	0.89
R4689:Rasa1	UTSW	13	85238163	nonsense	probably null
R4753:Rasa1	UTSW	13	85288390	splice site	probably null
R4758:Rasa1	UTSW	13	85234448	missense	probably benign
R5363:Rasa1	UTSW	13	85288555	missense	possibly damaging	0.86
R5375:Rasa1	UTSW	13	85288903	intron	probably benign
R6134:Rasa1	UTSW	13	85226626	missense	probably benign	0.01
R6190:Rasa1	UTSW	13	85233695	missense	probably benign	0.02
R6755:Rasa1	UTSW	13	85226598	missense	possibly damaging	0.49
R7564:Rasa1	UTSW	13	85228708	missense	probably benign	0.09
R7862:Rasa1	UTSW	13	85255411	missense	probably damaging	0.99
R9138:Rasa1	UTSW	13	85221516	missense	possibly damaging	0.93
R9280:Rasa1	UTSW	13	85288613	missense	unknown
R9328:Rasa1	UTSW	13	85255456	critical splice acceptor site	probably null
R9340:Rasa1	UTSW	13	85221530	missense	probably damaging	0.98
RF016:Rasa1	UTSW	13	85223488	missense	possibly damaging	0.65
X0023:Rasa1	UTSW	13	85233734	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCAGAAAGTCTTTTAGTTTGGTG -3'
(R):5'- ACTCTTAAGTGCACATTTACAATGG -3'

Sequencing Primer
(F):5'- AGTTCAAGGCCAGTCTGATC -3'
(R):5'- GTGCACATTTACAATGGAAACTAATG -3'

Posted On

2015-12-29