Incidental Mutation 'R4775:Olfr389'
List |< first << previous [record 46 of 66] next >> last >|
ID367861
Institutional Source Beutler Lab
Gene Symbol Olfr389
Ensembl Gene ENSMUSG00000070383
Gene Nameolfactory receptor 389
SynonymsMOR135-6, GA_x6K02T2P1NL-3932085-3931147
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73774849-73780713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73776551 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 259 (Y259H)
Ref Sequence ENSEMBL: ENSMUSP00000149734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122224] [ENSMUST00000124927] [ENSMUST00000215418]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118611
Predicted Effect probably damaging
Transcript: ENSMUST00000122224
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113364
Gene: ENSMUSG00000070383
AA Change: Y259H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124927
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115639
Gene: ENSMUSG00000070383
AA Change: Y259H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 221 6.6e-7 PFAM
Pfam:7tm_1 41 224 3.5e-29 PFAM
Pfam:7tm_4 139 224 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215418
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Olfr389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Olfr389 APN 11 73776706 missense probably benign 0.44
IGL01766:Olfr389 APN 11 73777075 missense probably benign 0.41
IGL01771:Olfr389 APN 11 73776664 missense probably damaging 1.00
IGL02535:Olfr389 APN 11 73776616 missense probably benign 0.00
IGL02639:Olfr389 APN 11 73776545 missense probably benign 0.21
IGL03060:Olfr389 APN 11 73776463 missense probably damaging 1.00
IGL03075:Olfr389 APN 11 73776472 missense probably damaging 1.00
R0081:Olfr389 UTSW 11 73777109 missense possibly damaging 0.59
R0426:Olfr389 UTSW 11 73776437 missense probably benign 0.13
R1140:Olfr389 UTSW 11 73776854 missense probably benign
R1638:Olfr389 UTSW 11 73777148 missense possibly damaging 0.95
R2001:Olfr389 UTSW 11 73776713 missense probably benign
R2214:Olfr389 UTSW 11 73776829 nonsense probably null
R3076:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3077:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3078:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3081:Olfr389 UTSW 11 73777225 missense probably damaging 1.00
R3430:Olfr389 UTSW 11 73776539 missense probably damaging 1.00
R3731:Olfr389 UTSW 11 73776739 missense probably benign 0.08
R4090:Olfr389 UTSW 11 73776841 missense probably damaging 1.00
R4303:Olfr389 UTSW 11 73776838 missense possibly damaging 0.78
R4516:Olfr389 UTSW 11 73777040 missense probably benign 0.06
R4556:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4557:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4858:Olfr389 UTSW 11 73776546 missense probably benign 0.44
R5015:Olfr389 UTSW 11 73777181 missense probably benign 0.07
R5087:Olfr389 UTSW 11 73777258 missense possibly damaging 0.75
R6599:Olfr389 UTSW 11 73776680 missense probably benign
R6701:Olfr389 UTSW 11 73776470 missense probably damaging 1.00
R6784:Olfr389 UTSW 11 73776850 missense probably damaging 1.00
R6916:Olfr389 UTSW 11 73777069 missense probably benign 0.00
R7066:Olfr389 UTSW 11 73777192 missense probably damaging 0.99
R7226:Olfr389 UTSW 11 73776677 missense possibly damaging 0.95
R7457:Olfr389 UTSW 11 73776826 missense probably benign 0.06
R7486:Olfr389 UTSW 11 73777021 missense probably damaging 1.00
R7990:Olfr389 UTSW 11 73776671 missense probably benign 0.00
R8289:Olfr389 UTSW 11 73777013 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTTCCATCCTTGTAGGTC -3'
(R):5'- CTTCTGAAGTTGTCTTGCTCAG -3'

Sequencing Primer
(F):5'- CCATCCTTGTAGGTCCTATGATGAG -3'
(R):5'- GCTCAGACACTTTTGTTAATGAGTTG -3'
Posted On2015-12-29