Incidental Mutation 'R4803:Tlk2'
ID370493
Institutional Source Beutler Lab
Gene Symbol Tlk2
Ensembl Gene ENSMUSG00000020694
Gene Nametousled-like kinase 2 (Arabidopsis)
Synonymsprotein kinase U-alpha, 4933403M19Rik, PKUalpha
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105178807-105283959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105281100 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 699 (C699S)
Ref Sequence ENSEMBL: ENSMUSP00000102554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015107] [ENSMUST00000092537] [ENSMUST00000106939] [ENSMUST00000106941] [ENSMUST00000126175] [ENSMUST00000145048]
Predicted Effect probably damaging
Transcript: ENSMUST00000015107
AA Change: C667S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015107
Gene: ENSMUSG00000020694
AA Change: C667S

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092537
SMART Domains Protein: ENSMUSP00000090198
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
Pfam:Pkinase 440 675 9.4e-52 PFAM
Pfam:Pkinase_Tyr 441 669 3.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106939
AA Change: C667S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102552
Gene: ENSMUSG00000020694
AA Change: C667S

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106941
AA Change: C699S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102554
Gene: ENSMUSG00000020694
AA Change: C699S

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
S_TKc 440 719 1.63e-78 SMART
low complexity region 728 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126175
SMART Domains Protein: ENSMUSP00000120944
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145048
SMART Domains Protein: ENSMUSP00000118520
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 170 205 N/A INTRINSIC
coiled coil region 253 282 N/A INTRINSIC
coiled coil region 323 361 N/A INTRINSIC
Pfam:Pkinase 376 611 2.4e-51 PFAM
Pfam:Pkinase_Tyr 377 605 8.5e-32 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear serine/threonine kinase that was first identified in Arabidopsis. The encoded protein is thought to function in the regulation of chromatin assembly in the S phase of the cell cycle by regulating the levels of a histone H3/H4 chaperone. This protein is associated with double-strand break repair of DNA damage caused by radiation. Pseudogenes of this gene are present on chromosomes 10 and 17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Tlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Tlk2 APN 11 105246795 nonsense probably null
IGL00956:Tlk2 APN 11 105247592 missense probably benign 0.01
IGL01083:Tlk2 APN 11 105221224 missense probably benign 0.11
IGL02523:Tlk2 APN 11 105275947 missense probably damaging 0.99
IGL02694:Tlk2 APN 11 105221235 missense probably benign 0.19
H8786:Tlk2 UTSW 11 105254979 missense possibly damaging 0.93
PIT4378001:Tlk2 UTSW 11 105281220 missense unknown
R0310:Tlk2 UTSW 11 105254973 missense probably benign 0.15
R1457:Tlk2 UTSW 11 105256952 critical splice donor site probably null
R1505:Tlk2 UTSW 11 105260295 missense probably damaging 1.00
R1856:Tlk2 UTSW 11 105221298 missense probably benign 0.00
R2069:Tlk2 UTSW 11 105240440 missense probably benign 0.22
R2305:Tlk2 UTSW 11 105241591 missense possibly damaging 0.47
R2351:Tlk2 UTSW 11 105209830 missense probably damaging 1.00
R3724:Tlk2 UTSW 11 105247564 missense probably benign 0.01
R4607:Tlk2 UTSW 11 105255018 missense probably damaging 1.00
R4641:Tlk2 UTSW 11 105275983 missense probably benign 0.41
R4738:Tlk2 UTSW 11 105256882 missense probably benign 0.22
R4957:Tlk2 UTSW 11 105253359 critical splice donor site probably null
R5407:Tlk2 UTSW 11 105240375 missense probably damaging 0.98
R5551:Tlk2 UTSW 11 105221307 missense probably benign 0.05
R6456:Tlk2 UTSW 11 105221273 missense probably benign 0.05
R6922:Tlk2 UTSW 11 105256953 critical splice donor site probably null
R7183:Tlk2 UTSW 11 105221359 splice site probably null
R7265:Tlk2 UTSW 11 105184244 nonsense probably null
R7760:Tlk2 UTSW 11 105279167 missense probably damaging 1.00
R7797:Tlk2 UTSW 11 105210618 missense probably benign 0.00
R7823:Tlk2 UTSW 11 105253307 missense probably damaging 1.00
Z1177:Tlk2 UTSW 11 105184290 missense not run
Predicted Primers PCR Primer
(F):5'- GTACTCAGCAAACCCCAGTG -3'
(R):5'- GCTGAATGCCGTATGTCCACTG -3'

Sequencing Primer
(F):5'- CAGTGCTGGTGCTGGCC -3'
(R):5'- GTCCACTGTGTGTGCTCAACAG -3'
Posted On2016-02-04