Incidental Mutation 'R4803:Ptprz1'
ID370457
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23001546 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1212 (S1212G)
Ref Sequence ENSEMBL: ENSMUSP00000144605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102] [ENSMUST00000202579]
Predicted Effect probably benign
Transcript: ENSMUST00000090568
AA Change: S1212G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: S1212G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201827
Predicted Effect probably benign
Transcript: ENSMUST00000202102
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202579
AA Change: S1212G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144605
Gene: ENSMUSG00000068748
AA Change: S1212G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 38 300 4e-103 SMART
FN3 312 397 2.8e-6 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
R7868:Ptprz1 UTSW 6 23000964 missense not run
R7882:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R7951:Ptprz1 UTSW 6 23000964 missense not run
R7965:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R8024:Ptprz1 UTSW 6 23042751 missense not run
Z1176:Ptprz1 UTSW 6 23051995 missense not run
Z1177:Ptprz1 UTSW 6 22999840 missense not run
Z1177:Ptprz1 UTSW 6 23052024 missense not run
Predicted Primers PCR Primer
(F):5'- CATCTCAAGCATCTGGGGACAC -3'
(R):5'- CGAGTGAGGAACTGTTAAGCC -3'

Sequencing Primer
(F):5'- CATCTGGGGACACTTGGCTTAAAC -3'
(R):5'- ACTGTTAAGCCTTGAAGTGGAG -3'
Posted On2016-02-04