Mutagenetix > Incidental Mutations

Incidental Mutation 'R4851:Exoc4'

373542

Institutional Source

Beutler Lab

Gene Symbol

Exoc4

Ensembl Gene

ENSMUSG00000029763

Gene Name

exocyst complex component 4

Synonyms

Sec8l1, Sec8

MMRRC Submission

042463-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33249085-33973979 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33918408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 787 (C787S)

Ref Sequence

ENSEMBL: ENSMUSP00000051965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052266]

AlphaFold

O35382

Predicted Effect

probably damaging
Transcript: ENSMUST00000052266
AA Change: C787S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: C787S

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	28	144	2.4e-21	PFAM
low complexity region	338	346	N/A	INTRINSIC

Meta Mutation Damage Score

0.5339

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	A	G	16: 4,976,274		noncoding transcript	Het
Abca13	A	T	11: 9,483,890	R4148S	probably benign	Het
Acoxl	T	A	2: 128,044,391	L182Q	possibly damaging	Het
Aldh7a1	T	C	18: 56,532,016	T364A	possibly damaging	Het
App	T	C	16: 85,056,434	D252G	unknown	Het
Arid1a	A	G	4: 133,681,361	I1945T	unknown	Het
Arsk	C	T	13: 76,065,279		probably null	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Best1	C	A	19: 9,991,698	R218L	probably damaging	Het
Cacna1e	A	T	1: 154,436,554		probably null	Het
Cdh13	C	T	8: 118,757,390	T130I	possibly damaging	Het
Cela2a	T	C	4: 141,825,591	E25G	probably benign	Het
Cgnl1	T	A	9: 71,725,032	I346F	probably damaging	Het
Chil6	C	T	3: 106,389,928	G299D	possibly damaging	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cnpy1	T	C	5: 28,245,740	I23V	probably benign	Het
Col6a3	T	A	1: 90,779,289	Y2034F	unknown	Het
Coq10b	T	C	1: 55,071,744	Y224H	probably benign	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Cyb5rl	T	G	4: 107,084,313	S252A	probably benign	Het
Cyp2ab1	T	A	16: 20,315,064	R125S	probably damaging	Het
Dclk1	G	A	3: 55,480,390	G86R	probably damaging	Het
Dmtn	A	G	14: 70,604,814	M382T	probably damaging	Het
Dnah12	T	A	14: 26,716,629	L471*	probably null	Het
Dock10	A	T	1: 80,549,157	S782T	probably benign	Het
Egfem1	C	A	3: 29,151,883	H90N	possibly damaging	Het
Ephb6	T	A	6: 41,618,145	W698R	probably benign	Het
Exosc8	A	T	3: 54,732,102		probably benign	Het
Galc	T	A	12: 98,227,274	Q352L	probably benign	Het
Galns	A	G	8: 122,600,533	Y167H	probably damaging	Het
Glb1l	T	C	1: 75,208,884		probably benign	Het
Gm6185	A	T	1: 161,206,180		noncoding transcript	Het
Gm7694	T	C	1: 170,301,225	N245S	probably benign	Het
Gmcl1	T	G	6: 86,704,556	K385N	possibly damaging	Het
Gramd1c	A	T	16: 43,989,837	W463R	probably damaging	Het
Gtpbp8	C	G	16: 44,746,070	A90P	probably benign	Het
Hcar1	T	C	5: 123,878,668	E320G	probably benign	Het
Hhatl	T	C	9: 121,789,011	D226G	probably damaging	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hoxc5	T	A	15: 103,015,369	I199N	probably damaging	Het
Iars2	T	C	1: 185,327,648	D121G	probably damaging	Het
Il5ra	T	A	6: 106,738,471	H134L	probably benign	Het
Isl2	T	A	9: 55,544,987	I281N	possibly damaging	Het
Kcnk13	T	C	12: 99,966,124	F60L	probably damaging	Het
Kdelr3	C	T	15: 79,524,865	T85M	possibly damaging	Het
Kdf1	A	T	4: 133,528,365	H131L	probably damaging	Het
Mipol1	T	A	12: 57,332,301	L182I	probably damaging	Het
Morc1	T	G	16: 48,561,617	S513R	probably benign	Het
Moxd2	A	T	6: 40,878,822	L611H	probably damaging	Het
Mpped2	T	C	2: 106,699,379		probably benign	Het
Mrpl51	T	C	6: 125,193,307	V92A	probably benign	Het
Mrps26	G	A	2: 130,563,761		probably benign	Het
Mrps5	A	G	2: 127,590,745	T29A	probably benign	Het
Mustn1	A	G	14: 30,879,560		probably benign	Het
Ncor2	G	A	5: 125,033,367	P858S	possibly damaging	Het
Nfasc	A	G	1: 132,602,021	F807S	probably damaging	Het
Nup50	G	A	15: 84,939,711	V422I	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr1212	A	G	2: 88,958,586	N40S	probably damaging	Het
Olfr384	A	T	11: 73,603,057	H159L	probably damaging	Het
Olfr411	C	A	11: 74,346,943	V214L	probably benign	Het
Olfr417	T	A	1: 174,368,996	F26L	probably benign	Het
Olfr539	A	T	7: 140,667,313	M2L	probably benign	Het
Olfr695	A	T	7: 106,874,014	V77D	probably damaging	Het
Olfr907	T	A	9: 38,499,023	M118K	probably damaging	Het
Osbpl8	T	A	10: 111,204,800	M1K	probably null	Het
Pcdhb22	A	C	18: 37,519,034	D185A	possibly damaging	Het
Pcdhga8	G	T	18: 37,816,404	R291L	probably damaging	Het
Saysd1	A	T	14: 20,077,604	L84Q	possibly damaging	Het
Slc41a1	T	C	1: 131,830,770	I50T	probably benign	Het
Smg7	G	A	1: 152,844,269	P834S	probably benign	Het
Speer4a	C	T	5: 26,038,212	V92M	probably damaging	Het
Srf	T	C	17: 46,549,474	T461A	probably benign	Het
Ssu72	A	G	4: 155,715,596	D72G	possibly damaging	Het
Suco	T	C	1: 161,834,192	E890G	probably damaging	Het
Tenm3	A	G	8: 48,310,621		probably null	Het
Tm6sf1	A	G	7: 81,865,343	E7G	probably null	Het
Tm9sf2	A	G	14: 122,141,204	K240R	probably benign	Het
Tmem52	T	A	4: 155,470,368	Y149*	probably null	Het
Tpgs2	A	T	18: 25,151,248	Y68N	possibly damaging	Het
Vmn1r205	T	A	13: 22,592,904	E9D	probably benign	Het
Vmn2r32	A	G	7: 7,479,954	V7A	possibly damaging	Het
Vmn2r80	T	C	10: 79,194,322	Y661H	possibly damaging	Het
Vps39	G	A	2: 120,321,831		probably benign	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Zfp641	T	A	15: 98,288,717	S342C	probably damaging	Het
Zfp961	T	C	8: 71,969,003		probably benign	Het

Other mutations in Exoc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Exoc4	APN	6	33918399	critical splice acceptor site	probably null
IGL00433:Exoc4	APN	6	33296788	missense	probably damaging	1.00
IGL00833:Exoc4	APN	6	33971924	missense	probably damaging	1.00
IGL01339:Exoc4	APN	6	33305400	splice site	probably benign
IGL01559:Exoc4	APN	6	33266076	missense	probably damaging	0.96
IGL01812:Exoc4	APN	6	33757959	splice site	probably benign
IGL01926:Exoc4	APN	6	33862142	missense	probably damaging	1.00
IGL02270:Exoc4	APN	6	33580026	missense	possibly damaging	0.61
IGL02316:Exoc4	APN	6	33910584	missense	probably damaging	0.98
IGL02332:Exoc4	APN	6	33249240	critical splice donor site	probably null
IGL02668:Exoc4	APN	6	33921532	missense	probably benign	0.00
slacker	UTSW	6	33758098	missense	probably damaging	1.00
R0049:Exoc4	UTSW	6	33296922	splice site	probably null
R0134:Exoc4	UTSW	6	33971946	missense	possibly damaging	0.56
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0538:Exoc4	UTSW	6	33972063	missense	probably benign	0.09
R1033:Exoc4	UTSW	6	33265987	missense	probably damaging	1.00
R1067:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R1109:Exoc4	UTSW	6	33442016	missense	probably damaging	1.00
R1768:Exoc4	UTSW	6	33758050	missense	probably damaging	1.00
R2013:Exoc4	UTSW	6	33266091	missense	probably damaging	0.96
R2078:Exoc4	UTSW	6	33910587	missense	probably benign	0.06
R2114:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2115:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2117:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2133:Exoc4	UTSW	6	33758158	missense	probably benign	0.00
R2133:Exoc4	UTSW	6	33910538	missense	probably benign
R2308:Exoc4	UTSW	6	33918568	missense	probably damaging	1.00
R3412:Exoc4	UTSW	6	33265975	missense	probably damaging	1.00
R3794:Exoc4	UTSW	6	33475997	missense	probably benign
R3885:Exoc4	UTSW	6	33266131	critical splice donor site	probably null
R4378:Exoc4	UTSW	6	33815687	missense	probably damaging	1.00
R4534:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4535:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4536:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4611:Exoc4	UTSW	6	33438405	missense	possibly damaging	0.77
R4617:Exoc4	UTSW	6	33862204	missense	probably benign	0.00
R4771:Exoc4	UTSW	6	33441949	critical splice acceptor site	probably null
R4921:Exoc4	UTSW	6	33910517	missense	probably benign
R5358:Exoc4	UTSW	6	33265999	missense	probably damaging	1.00
R5767:Exoc4	UTSW	6	33918432	missense	probably benign
R6014:Exoc4	UTSW	6	33475997	missense	probably benign
R6132:Exoc4	UTSW	6	33758098	missense	probably damaging	1.00
R6164:Exoc4	UTSW	6	33332283	missense	probably damaging	0.99
R6583:Exoc4	UTSW	6	33815753	missense	probably damaging	1.00
R6915:Exoc4	UTSW	6	33921453	missense	possibly damaging	0.81
R6973:Exoc4	UTSW	6	33580030	missense	probably damaging	1.00
R7112:Exoc4	UTSW	6	33921488	missense	probably damaging	1.00
R7129:Exoc4	UTSW	6	33971999	missense	probably damaging	1.00
R7133:Exoc4	UTSW	6	33438473	missense	probably benign	0.07
R7547:Exoc4	UTSW	6	33839121	missense	possibly damaging	0.95
R7885:Exoc4	UTSW	6	33758066	missense	probably benign	0.00
R8024:Exoc4	UTSW	6	33347931	missense	probably damaging	1.00
R8053:Exoc4	UTSW	6	33332256	missense	probably benign	0.45
R8118:Exoc4	UTSW	6	33971918	missense	probably damaging	1.00
R8154:Exoc4	UTSW	6	33910538	missense	probably benign
R8485:Exoc4	UTSW	6	33921501	missense	probably damaging	1.00
R9226:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R9402:Exoc4	UTSW	6	33476143	makesense	probably null
X0066:Exoc4	UTSW	6	33815690	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACCTGCTTGCTTCAGATC -3'
(R):5'- AGGCTTCTAGACACAGAGGTCAG -3'

Sequencing Primer
(F):5'- TGCTTCAGATCACTCAGCTATG -3'
(R):5'- TTCTAGACACAGAGGTCAGCTCTG -3'

Posted On

2016-03-01