Incidental Mutation 'R4851:Exoc4'
ID 373542
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Name exocyst complex component 4
Synonyms Sec8l1, Sec8
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4851 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 33249085-33973979 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33918408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 787 (C787S)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
AlphaFold O35382
Predicted Effect probably damaging
Transcript: ENSMUST00000052266
AA Change: C787S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: C787S

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Meta Mutation Damage Score 0.5339 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
R7547:Exoc4 UTSW 6 33839121 missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R8024:Exoc4 UTSW 6 33347931 missense probably damaging 1.00
R8053:Exoc4 UTSW 6 33332256 missense probably benign 0.45
R8118:Exoc4 UTSW 6 33971918 missense probably damaging 1.00
R8154:Exoc4 UTSW 6 33910538 missense probably benign
R8485:Exoc4 UTSW 6 33921501 missense probably damaging 1.00
R9226:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R9402:Exoc4 UTSW 6 33476143 makesense probably null
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCTGCTTGCTTCAGATC -3'
(R):5'- AGGCTTCTAGACACAGAGGTCAG -3'

Sequencing Primer
(F):5'- TGCTTCAGATCACTCAGCTATG -3'
(R):5'- TTCTAGACACAGAGGTCAGCTCTG -3'
Posted On 2016-03-01