Mutagenetix > Incidental Mutations

Incidental Mutation 'R1109:Exoc4'

98635

Institutional Source

Beutler Lab

Gene Symbol

Exoc4

Ensembl Gene

ENSMUSG00000029763

Gene Name

exocyst complex component 4

Synonyms

Sec8l1, Sec8

MMRRC Submission

039182-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1109 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33249085-33973979 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33442016 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 466 (Y466C)

Ref Sequence

ENSEMBL: ENSMUSP00000110732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052266] [ENSMUST00000090381] [ENSMUST00000115080]

Predicted Effect

probably damaging
Transcript: ENSMUST00000052266
AA Change: Y466C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: Y466C

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	28	144	2.4e-21	PFAM
low complexity region	338	346	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090381
AA Change: Y466C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087859
Gene: ENSMUSG00000029763
AA Change: Y466C

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	24	144	1.1e-36	PFAM
low complexity region	338	346	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115080
AA Change: Y466C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110732
Gene: ENSMUSG00000029763
AA Change: Y466C

Domain	Start	End	E-Value	Type
Pfam:Sec8_exocyst	24	144	7.4e-37	PFAM
low complexity region	338	346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152835

Meta Mutation Damage Score

0.4687

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 88.9%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	A	T	7: 118,775,329	I351F	probably damaging	Het
Abcd3	T	G	3: 121,779,596	E262D	probably damaging	Het
Abcg1	G	A	17: 31,111,236	A504T	probably benign	Het
Acot11	T	C	4: 106,749,348	T515A	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Arhgap44	T	A	11: 65,026,816	H375L	probably benign	Het
Aspm	A	T	1: 139,456,758	I98F	probably damaging	Het
Atp8b5	T	C	4: 43,305,719		probably benign	Het
Ccdc129	G	T	6: 55,968,260	K655N	probably damaging	Het
Coa3	T	C	11: 101,278,785	K48R	probably damaging	Het
Col12a1	A	G	9: 79,699,723	S473P	probably damaging	Het
Dnmt1	A	T	9: 20,922,388	Y451N	probably damaging	Het
Dock5	A	G	14: 67,806,478	Y819H	possibly damaging	Het
Dtx1	G	A	5: 120,710,419		probably benign	Het
Dus2	T	A	8: 106,053,482	F479I	probably benign	Het
Esrp1	T	C	4: 11,365,205	E262G	probably damaging	Het
Fasn	A	G	11: 120,812,324	F1625S	possibly damaging	Het
Fbxw25	A	T	9: 109,650,060	H374Q	probably benign	Het
Focad	T	C	4: 88,196,747		probably benign	Het
Gad2	G	T	2: 22,681,394	R448L	probably damaging	Het
Gad2	G	A	2: 22,690,159		probably benign	Het
Galnt16	G	T	12: 80,590,631	E377D	probably benign	Het
Gcc1	A	C	6: 28,419,167	L389R	probably damaging	Het
Ggct	A	T	6: 54,989,569		probably benign	Het
Gm7052	G	A	17: 22,040,152		probably benign	Het
Gps2	T	A	11: 69,915,681	H177Q	possibly damaging	Het
Heg1	T	A	16: 33,763,591	L1256Q	probably damaging	Het
Ikbkap	T	C	4: 56,786,723	T407A	probably benign	Het
Il1f6	G	A	2: 24,216,590	G62E	probably damaging	Het
Il3ra	C	T	14: 14,349,317	R138W	probably damaging	Het
Kdm4b	T	A	17: 56,399,430	I848N	probably damaging	Het
L3hypdh	A	G	12: 72,073,996	V327A	possibly damaging	Het
Lepr	G	T	4: 101,771,355	L552F	probably damaging	Het
Lpin3	T	C	2: 160,899,021	I449T	probably damaging	Het
Lrrn1	A	G	6: 107,567,264	K8E	probably benign	Het
Mex3a	G	T	3: 88,536,660	D348Y	possibly damaging	Het
Mindy2	G	A	9: 70,631,079	R325*	probably null	Het
Mkrn1	A	T	6: 39,399,334	M382K	probably damaging	Het
Mroh1	G	T	15: 76,446,509		probably benign	Het
Myo15	T	A	11: 60,493,066	D1646E	probably damaging	Het
Neu2	A	G	1: 87,596,728	D145G	probably damaging	Het
Olfr317	T	C	11: 58,732,916	Y83C	probably benign	Het
Olfr718-ps1	A	T	5: 143,137,619	N216K	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Plekhm2	T	A	4: 141,627,984	I938F	probably benign	Het
Pnmal1	A	T	7: 16,961,467	K416*	probably null	Het
Ppid	T	C	3: 79,598,861	S198P	probably benign	Het
Rabl6	G	T	2: 25,587,526	P304Q	probably damaging	Het
Rasal2	A	T	1: 157,177,638		probably benign	Het
Ripor1	G	T	8: 105,618,928		probably benign	Het
Rnf216	A	T	5: 143,068,369	L658Q	probably damaging	Het
Rnf219	A	T	14: 104,479,764	L391*	probably null	Het
Safb	T	A	17: 56,601,228		probably benign	Het
Sf3b5	T	C	10: 13,008,753	M44T	probably benign	Het
Slc26a9	A	T	1: 131,758,798	M419L	probably benign	Het
Slc38a8	T	C	8: 119,482,655	D393G	probably benign	Het
Slc6a3	A	G	13: 73,557,080	D230G	probably benign	Het
Smc1b	T	C	15: 85,112,815	T535A	probably damaging	Het
Smg7	G	C	1: 152,845,583	P626R	probably damaging	Het
Smu1	C	T	4: 40,755,722	V48M	probably benign	Het
Spag17	T	C	3: 100,027,351	Y650H	possibly damaging	Het
Spata1	C	T	3: 146,475,298	V302I	possibly damaging	Het
Sptb	G	A	12: 76,603,603	A1780V	probably damaging	Het
Srrm2	G	A	17: 23,819,617		probably benign	Het
Sspo	A	C	6: 48,497,443	N4933H	probably damaging	Het
Sult2a2	T	C	7: 13,734,873	I88T	probably benign	Het
Tgfa	G	T	6: 86,270,090		probably benign	Het
Thsd1	T	A	8: 22,243,692	C252S	possibly damaging	Het
Tmem102	T	A	11: 69,804,804	H114L	probably damaging	Het
Tnni3k	T	A	3: 154,792,777	K808N	possibly damaging	Het
Trpm7	G	T	2: 126,797,793	L1628M	probably benign	Het
Ttn	A	G	2: 76,730,737	Y29107H	probably damaging	Het
Upb1	T	C	10: 75,438,165	L342P	probably damaging	Het
Vmn2r120	T	C	17: 57,525,829	T117A	probably benign	Het
Vmn2r16	A	G	5: 109,339,786	D175G	probably damaging	Het
Zfhx4	T	G	3: 5,399,870	M1696R	possibly damaging	Het
Zfp746	A	G	6: 48,064,922	V289A	possibly damaging	Het
Zfyve26	A	C	12: 79,272,127	F1146V	probably damaging	Het

Other mutations in Exoc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Exoc4	APN	6	33918399	critical splice acceptor site	probably null
IGL00433:Exoc4	APN	6	33296788	missense	probably damaging	1.00
IGL00833:Exoc4	APN	6	33971924	missense	probably damaging	1.00
IGL01339:Exoc4	APN	6	33305400	splice site	probably benign
IGL01559:Exoc4	APN	6	33266076	missense	probably damaging	0.96
IGL01812:Exoc4	APN	6	33757959	splice site	probably benign
IGL01926:Exoc4	APN	6	33862142	missense	probably damaging	1.00
IGL02270:Exoc4	APN	6	33580026	missense	possibly damaging	0.61
IGL02316:Exoc4	APN	6	33910584	missense	probably damaging	0.98
IGL02332:Exoc4	APN	6	33249240	critical splice donor site	probably null
IGL02668:Exoc4	APN	6	33921532	missense	probably benign	0.00
slacker	UTSW	6	33758098	missense	probably damaging	1.00
R0049:Exoc4	UTSW	6	33296922	splice site	probably null
R0134:Exoc4	UTSW	6	33971946	missense	possibly damaging	0.56
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0234:Exoc4	UTSW	6	33862087	missense	possibly damaging	0.89
R0538:Exoc4	UTSW	6	33972063	missense	probably benign	0.09
R1033:Exoc4	UTSW	6	33265987	missense	probably damaging	1.00
R1067:Exoc4	UTSW	6	33918424	missense	possibly damaging	0.87
R1768:Exoc4	UTSW	6	33758050	missense	probably damaging	1.00
R2013:Exoc4	UTSW	6	33266091	missense	probably damaging	0.96
R2078:Exoc4	UTSW	6	33910587	missense	probably benign	0.06
R2114:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2115:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2117:Exoc4	UTSW	6	33347825	missense	possibly damaging	0.74
R2133:Exoc4	UTSW	6	33758158	missense	probably benign	0.00
R2133:Exoc4	UTSW	6	33910538	missense	probably benign
R2308:Exoc4	UTSW	6	33918568	missense	probably damaging	1.00
R3412:Exoc4	UTSW	6	33265975	missense	probably damaging	1.00
R3794:Exoc4	UTSW	6	33475997	missense	probably benign
R3885:Exoc4	UTSW	6	33266131	critical splice donor site	probably null
R4378:Exoc4	UTSW	6	33815687	missense	probably damaging	1.00
R4534:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4535:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4536:Exoc4	UTSW	6	33277244	missense	probably damaging	1.00
R4611:Exoc4	UTSW	6	33438405	missense	possibly damaging	0.77
R4617:Exoc4	UTSW	6	33862204	missense	probably benign	0.00
R4771:Exoc4	UTSW	6	33441949	critical splice acceptor site	probably null
R4851:Exoc4	UTSW	6	33918408	missense	probably damaging	0.96
R4921:Exoc4	UTSW	6	33910517	missense	probably benign
R5358:Exoc4	UTSW	6	33265999	missense	probably damaging	1.00
R5767:Exoc4	UTSW	6	33918432	missense	probably benign
R6014:Exoc4	UTSW	6	33475997	missense	probably benign
R6132:Exoc4	UTSW	6	33758098	missense	probably damaging	1.00
R6164:Exoc4	UTSW	6	33332283	missense	probably damaging	0.99
R6583:Exoc4	UTSW	6	33815753	missense	probably damaging	1.00
R6915:Exoc4	UTSW	6	33921453	missense	possibly damaging	0.81
R6973:Exoc4	UTSW	6	33580030	missense	probably damaging	1.00
R7112:Exoc4	UTSW	6	33921488	missense	probably damaging	1.00
R7129:Exoc4	UTSW	6	33971999	missense	probably damaging	1.00
R7133:Exoc4	UTSW	6	33438473	missense	probably benign	0.07
R7547:Exoc4	UTSW	6	33839121	missense	possibly damaging	0.95
R7885:Exoc4	UTSW	6	33758066	missense	probably benign	0.00
R8024:Exoc4	UTSW	6	33347931	missense	probably damaging	1.00
R8053:Exoc4	UTSW	6	33332256	missense	probably benign	0.45
R8118:Exoc4	UTSW	6	33971918	missense	probably damaging	1.00
R8154:Exoc4	UTSW	6	33910538	missense	probably benign
R8485:Exoc4	UTSW	6	33921501	missense	probably damaging	1.00
X0066:Exoc4	UTSW	6	33815690	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTCACGCTCGCTCTAAGATGATG -3'
(R):5'- TCCACCTCAATGGCAAGGCATTC -3'

Sequencing Primer
(F):5'- GCTCGCTCTAAGATGATGATGAC -3'
(R):5'- CCTCAATGGCAAGGCATTCTTTAG -3'

Posted On

2014-01-05