Incidental Mutation 'R4974:Ppp3ca'
ID382469
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Nameprotein phosphatase 3, catalytic subunit, alpha isoform
SynonymsCaln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission 042569-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4974 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location136670124-136937727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 136935049 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 454 (Q454K)
Ref Sequence ENSEMBL: ENSMUSP00000071040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
Predicted Effect probably benign
Transcript: ENSMUST00000056758
AA Change: Q464K

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: Q464K

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070198
AA Change: Q454K

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: Q454K

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (94/97)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,287 F655Y probably damaging Het
A730061H03Rik C T 14: 55,560,117 probably benign Het
Acsf2 A C 11: 94,569,329 M399R possibly damaging Het
Adra2c C A 5: 35,280,924 R347S probably benign Het
Akap9 A G 5: 3,961,466 K723R possibly damaging Het
Anxa9 A C 3: 95,308,013 probably benign Het
Aqr T C 2: 114,113,351 H1102R probably damaging Het
Arrdc2 A G 8: 70,837,518 V173A probably benign Het
Aspm T C 1: 139,478,010 V1545A probably benign Het
Bbs5 C T 2: 69,647,234 probably benign Het
Bnip2 A G 9: 70,003,434 T255A possibly damaging Het
Cacna1b T C 2: 24,648,523 T1531A probably damaging Het
Cast T C 13: 74,807,823 K9R probably benign Het
Cfap46 A T 7: 139,607,188 probably null Het
Cfap57 G T 4: 118,593,054 L624M probably damaging Het
Cyp2c39 A T 19: 39,563,879 M339L probably benign Het
Dcst1 T A 3: 89,357,803 T247S probably benign Het
Dnajc18 T A 18: 35,683,319 I189F possibly damaging Het
Eef2kmt T C 16: 5,249,012 T126A probably benign Het
Epha2 A G 4: 141,321,705 E624G probably damaging Het
Erbb3 G A 10: 128,572,448 H866Y probably benign Het
F13a1 C T 13: 36,916,863 probably null Het
Fgd3 T A 13: 49,278,602 N392I probably damaging Het
Fgf7 A T 2: 126,088,240 M98L probably benign Het
G2e3 T A 12: 51,369,139 S553T probably benign Het
Glipr1 C A 10: 111,993,506 E117* probably null Het
Gm11060 A T 2: 105,093,783 probably benign Het
Gm4787 A G 12: 81,377,629 I585T probably damaging Het
Gm6055 A T 14: 48,079,458 noncoding transcript Het
Gpbar1 TACCAC TAC 1: 74,279,545 probably benign Het
Gpt2 T A 8: 85,519,439 probably benign Het
Gtf2ird1 A T 5: 134,357,831 Y345* probably null Het
Hmcn1 T A 1: 150,819,449 T235S probably benign Het
Igkv5-48 A G 6: 69,726,754 Y56H possibly damaging Het
Il17re C T 6: 113,469,569 T427I probably benign Het
Itpr3 A T 17: 27,083,608 D80V probably damaging Het
Kif21a G T 15: 90,949,010 H1317N probably benign Het
Kif28 T C 1: 179,698,644 K144E probably damaging Het
Kif4-ps A C 12: 101,147,071 noncoding transcript Het
Klk11 C T 7: 43,777,736 T148I probably damaging Het
Klkb1 T A 8: 45,286,958 H99L probably damaging Het
Kpna6 A C 4: 129,656,405 probably null Het
Lama3 G T 18: 12,552,826 K1132N probably damaging Het
Lcp1 T A 14: 75,208,471 L264* probably null Het
Map2 T C 1: 66,413,505 V360A probably benign Het
Med13 A T 11: 86,298,847 S1079T probably damaging Het
Mettl13 A G 1: 162,537,220 M162T probably damaging Het
Mppe1 T G 18: 67,228,062 E208A probably benign Het
Msantd2 A C 9: 37,489,379 K19T possibly damaging Het
Mylk3 A G 8: 85,364,783 V131A probably damaging Het
Myocd A T 11: 65,183,473 S609T possibly damaging Het
Ncbp3 G A 11: 73,053,529 probably null Het
Neb T A 2: 52,246,859 L3203F probably damaging Het
Notch2 C A 3: 98,139,633 T1756K probably benign Het
Nphp4 A T 4: 152,537,793 R544W probably damaging Het
Olfr1179 T G 2: 88,402,412 H174P probably damaging Het
Olfr368 A T 2: 37,332,566 D273V probably damaging Het
Olfr402 A T 11: 74,155,919 Y255F probably benign Het
Parp4 T A 14: 56,589,898 V163E possibly damaging Het
Pcdhgb1 C A 18: 37,682,372 Q639K probably benign Het
Pcnx2 A G 8: 125,851,130 V936A probably benign Het
Pcsk7 T A 9: 45,918,862 M418K probably damaging Het
Pglyrp4 T C 3: 90,733,007 I188T probably benign Het
Pgs1 A G 11: 118,005,519 R339G probably benign Het
Pik3r3 A G 4: 116,286,191 I294V probably benign Het
Pik3r6 A G 11: 68,539,945 D520G probably damaging Het
Pkdrej A G 15: 85,820,409 V442A probably benign Het
Ppfibp1 T A 6: 147,030,419 probably benign Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prl4a1 A T 13: 28,023,325 Y194F possibly damaging Het
Ptpn21 G T 12: 98,680,103 T1032K probably damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Ptprm T A 17: 66,678,067 R1447S probably benign Het
Pxk T A 14: 8,140,734 D236E probably damaging Het
Qars T C 9: 108,508,931 F107S probably damaging Het
Rbbp6 A G 7: 122,999,808 probably benign Het
Rptor A T 11: 119,821,640 probably benign Het
Rtn4 T A 11: 29,740,994 M1095K probably damaging Het
Serpinb3b T A 1: 107,154,715 H273L probably benign Het
Sgce G A 6: 4,689,630 T401M probably benign Het
Slc12a6 C T 2: 112,358,525 R1083W probably damaging Het
Slc45a4 A T 15: 73,584,450 M635K probably damaging Het
Slc6a1 T A 6: 114,307,701 V240D probably damaging Het
Snx9 G A 17: 5,902,519 probably null Het
Spred3 A G 7: 29,167,824 V49A probably damaging Het
Tars A G 15: 11,390,391 F334S probably damaging Het
Tdpoz1 A G 3: 93,671,147 V110A probably benign Het
Tfrc T G 16: 32,618,279 V252G probably damaging Het
Tm6sf2 T C 8: 70,075,478 probably benign Het
Txlnb T C 10: 17,838,969 V383A probably damaging Het
Utp20 C A 10: 88,816,949 V368L probably benign Het
Vmn2r12 A T 5: 109,091,506 V397E probably damaging Het
Zdhhc12 G A 2: 30,091,526 R175W probably damaging Het
Zfyve9 A G 4: 108,680,900 probably null Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136935181 missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136868721 missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136797863 missense probably benign
IGL02285:Ppp3ca APN 3 136928626 splice site probably benign
IGL02472:Ppp3ca APN 3 136921862 missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136905318 missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136797812 missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136935139 missense probably benign 0.15
R1072:Ppp3ca UTSW 3 136935127 missense probably benign
R1427:Ppp3ca UTSW 3 136921914 missense probably damaging 1.00
R1524:Ppp3ca UTSW 3 136797818 missense probably benign
R1568:Ppp3ca UTSW 3 136928544 missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136881448 missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136935031 missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136921911 missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136797878 missense probably benign 0.03
R2155:Ppp3ca UTSW 3 136890450 missense possibly damaging 0.95
R2160:Ppp3ca UTSW 3 136877630 missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136797924 missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136797819 missense probably benign
R3052:Ppp3ca UTSW 3 136797844 missense probably benign 0.00
R3500:Ppp3ca UTSW 3 136881512 missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136890489 missense probably damaging 0.99
R5952:Ppp3ca UTSW 3 136928571 missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136876122 missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136877770 missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136905301 missense probably damaging 1.00
R7121:Ppp3ca UTSW 3 136868626 missense probably damaging 1.00
R7720:Ppp3ca UTSW 3 136890489 missense probably damaging 1.00
R7773:Ppp3ca UTSW 3 136890461 missense probably benign
R7828:Ppp3ca UTSW 3 136797774 missense probably damaging 1.00
R7830:Ppp3ca UTSW 3 136868720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGTTTCCAAACCCTTG -3'
(R):5'- AGGAAGTGGTCACTGGATATTG -3'

Sequencing Primer
(F):5'- TCCCTCCGGTATGGTAAGGAATC -3'
(R):5'- ACTGGATATTGCTGCTATTACTGC -3'
Posted On2016-04-27