Incidental Mutation 'R4988:Proser1'
ID385941
Institutional Source Beutler Lab
Gene Symbol Proser1
Ensembl Gene ENSMUSG00000049504
Gene Nameproline and serine rich 1
Synonyms2810046L04Rik
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4988 (G1)
Quality Score212
Status Validated
Chromosome3
Chromosomal Location53463666-53481755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53479625 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 845 (I845T)
Ref Sequence ENSEMBL: ENSMUSP00000055253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058577]
Predicted Effect probably damaging
Transcript: ENSMUST00000058577
AA Change: I845T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: I845T

DomainStartEndE-ValueType
Pfam:DUF4476 1 63 5e-12 PFAM
Pfam:DUF4476 30 121 4e-27 PFAM
low complexity region 227 246 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 696 718 N/A INTRINSIC
low complexity region 781 804 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 820 834 N/A INTRINSIC
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200328
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Proser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Proser1 APN 3 53478830 missense probably benign 0.00
IGL02217:Proser1 APN 3 53471491 missense probably damaging 0.96
IGL02260:Proser1 APN 3 53478944 missense probably damaging 1.00
IGL02943:Proser1 APN 3 53479103 missense probably damaging 0.98
donatello UTSW 3 53467151 missense probably damaging 1.00
R0166:Proser1 UTSW 3 53480617 missense possibly damaging 0.89
R0230:Proser1 UTSW 3 53478962 missense probably damaging 0.99
R0579:Proser1 UTSW 3 53467151 missense probably damaging 1.00
R0599:Proser1 UTSW 3 53479064 missense probably benign 0.04
R0616:Proser1 UTSW 3 53474697 missense probably damaging 0.98
R0622:Proser1 UTSW 3 53477860 missense probably benign 0.22
R0629:Proser1 UTSW 3 53479064 missense probably benign 0.04
R0707:Proser1 UTSW 3 53478776 missense probably damaging 1.00
R1568:Proser1 UTSW 3 53477759 missense possibly damaging 0.54
R1997:Proser1 UTSW 3 53478871 missense probably benign 0.10
R2129:Proser1 UTSW 3 53477945 missense probably benign 0.20
R2207:Proser1 UTSW 3 53478391 missense probably benign 0.00
R2851:Proser1 UTSW 3 53480545 missense probably benign 0.07
R4077:Proser1 UTSW 3 53478541 missense probably damaging 1.00
R4093:Proser1 UTSW 3 53479712 critical splice donor site probably null
R4970:Proser1 UTSW 3 53464306 missense probably damaging 1.00
R5611:Proser1 UTSW 3 53478875 missense probably benign 0.10
R6090:Proser1 UTSW 3 53478667 missense probably benign 0.00
R6146:Proser1 UTSW 3 53478119 missense probably damaging 1.00
R6459:Proser1 UTSW 3 53478329 missense possibly damaging 0.51
R6880:Proser1 UTSW 3 53477839 missense probably benign
R7308:Proser1 UTSW 3 53478704 missense probably benign 0.40
R7456:Proser1 UTSW 3 53478518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTGACTCATTCCTGCAC -3'
(R):5'- AGAACGAATGAAACCAATCTTCTGG -3'

Sequencing Primer
(F):5'- CTACAGAGGAGCTCATTTGTTCGC -3'
(R):5'- ACCAATCTTCTGGATTCTGGTAAGC -3'
Posted On2016-05-10