Incidental Mutation 'R0629:Proser1'
ID57740
Institutional Source Beutler Lab
Gene Symbol Proser1
Ensembl Gene ENSMUSG00000049504
Gene Nameproline and serine rich 1
Synonyms2810046L04Rik
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location53463666-53481755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53479064 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 789 (P789Q)
Ref Sequence ENSEMBL: ENSMUSP00000055253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058577]
Predicted Effect probably benign
Transcript: ENSMUST00000058577
AA Change: P789Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055253
Gene: ENSMUSG00000049504
AA Change: P789Q

DomainStartEndE-ValueType
Pfam:DUF4476 1 63 5e-12 PFAM
Pfam:DUF4476 30 121 4e-27 PFAM
low complexity region 227 246 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 696 718 N/A INTRINSIC
low complexity region 781 804 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 820 834 N/A INTRINSIC
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200328
Meta Mutation Damage Score 0.2547 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Proser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Proser1 APN 3 53478830 missense probably benign 0.00
IGL02217:Proser1 APN 3 53471491 missense probably damaging 0.96
IGL02260:Proser1 APN 3 53478944 missense probably damaging 1.00
IGL02943:Proser1 APN 3 53479103 missense probably damaging 0.98
donatello UTSW 3 53467151 missense probably damaging 1.00
R0166:Proser1 UTSW 3 53480617 missense possibly damaging 0.89
R0230:Proser1 UTSW 3 53478962 missense probably damaging 0.99
R0579:Proser1 UTSW 3 53467151 missense probably damaging 1.00
R0599:Proser1 UTSW 3 53479064 missense probably benign 0.04
R0616:Proser1 UTSW 3 53474697 missense probably damaging 0.98
R0622:Proser1 UTSW 3 53477860 missense probably benign 0.22
R0707:Proser1 UTSW 3 53478776 missense probably damaging 1.00
R1568:Proser1 UTSW 3 53477759 missense possibly damaging 0.54
R1997:Proser1 UTSW 3 53478871 missense probably benign 0.10
R2129:Proser1 UTSW 3 53477945 missense probably benign 0.20
R2207:Proser1 UTSW 3 53478391 missense probably benign 0.00
R2851:Proser1 UTSW 3 53480545 missense probably benign 0.07
R4077:Proser1 UTSW 3 53478541 missense probably damaging 1.00
R4093:Proser1 UTSW 3 53479712 critical splice donor site probably null
R4970:Proser1 UTSW 3 53464306 missense probably damaging 1.00
R4988:Proser1 UTSW 3 53479625 missense probably damaging 0.98
R5611:Proser1 UTSW 3 53478875 missense probably benign 0.10
R6090:Proser1 UTSW 3 53478667 missense probably benign 0.00
R6146:Proser1 UTSW 3 53478119 missense probably damaging 1.00
R6459:Proser1 UTSW 3 53478329 missense possibly damaging 0.51
R6880:Proser1 UTSW 3 53477839 missense probably benign
R7308:Proser1 UTSW 3 53478704 missense probably benign 0.40
R7456:Proser1 UTSW 3 53478518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTGCCCATCAGTGTGTCTACTTG -3'
(R):5'- CTTGGTGAGAAGTGACTCGAACCTG -3'

Sequencing Primer
(F):5'- CCCTAGCTCTGCAACAGTG -3'
(R):5'- AAGTGACTCGAACCTGTCTGC -3'
Posted On2013-07-11