Incidental Mutation 'R4988:Col9a1'
ID 385933
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Name collagen, type IX, alpha 1
Synonyms Col9a-1
MMRRC Submission 042582-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R4988 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 24216691-24291765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24224273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000054588
AA Change: S152P
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: S152P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Meta Mutation Damage Score 0.5055 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,670,447 (GRCm39) G223E probably damaging Het
Abcb11 T C 2: 69,154,236 (GRCm39) N110S probably benign Het
Acaca T A 11: 84,154,121 (GRCm39) H947Q probably damaging Het
Akap13 T C 7: 75,380,276 (GRCm39) M2202T probably damaging Het
Amy2b T C 3: 113,058,550 (GRCm39) noncoding transcript Het
Arhgef4 A T 1: 34,762,535 (GRCm39) H597L unknown Het
Asgr2 A G 11: 69,988,665 (GRCm39) I119M probably benign Het
Casc3 T G 11: 98,712,700 (GRCm39) probably null Het
Cbr1b A G 16: 93,426,884 (GRCm39) T162A probably benign Het
Ccdc7b T A 8: 129,872,013 (GRCm39) M239K possibly damaging Het
Cdc27 A G 11: 104,416,950 (GRCm39) S334P possibly damaging Het
Ces1c T C 8: 93,827,336 (GRCm39) E476G probably damaging Het
Clec3a T A 8: 115,144,827 (GRCm39) M1K probably null Het
Cpd A G 11: 76,705,656 (GRCm39) S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 (GRCm39) L95* probably null Het
Dhx57 T C 17: 80,558,827 (GRCm39) D1044G probably damaging Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Efcab5 A G 11: 77,028,078 (GRCm39) S418P probably damaging Het
Elp5 T C 11: 69,870,668 (GRCm39) D59G probably benign Het
Fam210a G A 18: 68,409,218 (GRCm39) R31C probably benign Het
Farp1 A G 14: 121,513,019 (GRCm39) T792A probably damaging Het
Fmc1 A T 6: 38,511,917 (GRCm39) Y37F probably benign Het
Gm10717 T A 9: 3,026,368 (GRCm39) L72M probably benign Het
Gm1758 A T 16: 14,320,067 (GRCm39) noncoding transcript Het
Gm4553 G A 7: 141,718,729 (GRCm39) probably benign Het
Gpr156 A G 16: 37,768,577 (GRCm39) T33A possibly damaging Het
Hhat A T 1: 192,339,602 (GRCm39) probably benign Het
Hint2 T C 4: 43,654,953 (GRCm39) I59V possibly damaging Het
Hps4 C T 5: 112,526,019 (GRCm39) probably benign Het
Hsd17b8 A G 17: 34,246,262 (GRCm39) F137S probably damaging Het
Klrc2 A T 6: 129,633,426 (GRCm39) C192S probably benign Het
Map1a C T 2: 121,133,531 (GRCm39) T1211I probably benign Het
Mtus1 T C 8: 41,537,578 (GRCm39) N46S probably benign Het
Myo18a T C 11: 77,736,347 (GRCm39) probably null Het
Nbas T C 12: 13,458,266 (GRCm39) S1258P probably benign Het
Ndst1 C T 18: 60,836,005 (GRCm39) G426D probably damaging Het
Nepro A G 16: 44,554,905 (GRCm39) E327G possibly damaging Het
Nutm2 C T 13: 50,626,379 (GRCm39) T322I possibly damaging Het
Or10s1 G A 9: 39,985,961 (GRCm39) M123I probably damaging Het
Or1j18 T C 2: 36,624,996 (GRCm39) I221T possibly damaging Het
Or2m13 A T 16: 19,225,860 (GRCm39) M302K probably benign Het
Or6c66 T C 10: 129,461,930 (GRCm39) probably null Het
Pcdhb15 G A 18: 37,608,855 (GRCm39) A696T probably damaging Het
Polm C A 11: 5,787,618 (GRCm39) R45L probably damaging Het
Pon3 G A 6: 5,254,582 (GRCm39) R27* probably null Het
Proser1 T C 3: 53,387,046 (GRCm39) I845T probably damaging Het
Rassf8 A G 6: 145,762,870 (GRCm39) N406D possibly damaging Het
Skint10 A T 4: 112,586,069 (GRCm39) C182* probably null Het
Slc6a19 C T 13: 73,833,959 (GRCm39) W366* probably null Het
St7 T C 6: 17,934,225 (GRCm39) F470L probably damaging Het
St8sia4 T A 1: 95,519,522 (GRCm39) Y322F possibly damaging Het
Trav8n-2 A T 14: 53,975,814 (GRCm39) probably benign Het
Vwa8 A T 14: 79,435,723 (GRCm39) H1811L probably benign Het
Zfp14 G A 7: 29,737,482 (GRCm39) T501I probably benign Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24,224,306 (GRCm39) missense unknown
IGL00517:Col9a1 APN 1 24,234,615 (GRCm39) intron probably benign
IGL01125:Col9a1 APN 1 24,263,726 (GRCm39) critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24,224,205 (GRCm39) missense unknown
IGL01583:Col9a1 APN 1 24,224,225 (GRCm39) missense unknown
IGL01627:Col9a1 APN 1 24,218,689 (GRCm39) critical splice donor site probably null
IGL01773:Col9a1 APN 1 24,244,147 (GRCm39) missense probably benign 0.17
IGL02117:Col9a1 APN 1 24,276,574 (GRCm39) nonsense probably null
IGL02192:Col9a1 APN 1 24,261,068 (GRCm39) missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24,262,690 (GRCm39) missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24,224,339 (GRCm39) missense unknown
IGL02453:Col9a1 APN 1 24,218,438 (GRCm39) missense unknown
IGL02553:Col9a1 APN 1 24,261,018 (GRCm39) splice site probably benign
IGL03412:Col9a1 APN 1 24,249,508 (GRCm39) critical splice donor site probably null
IGL03493:Col9a1 APN 1 24,260,651 (GRCm39) splice site probably benign
ANU74:Col9a1 UTSW 1 24,224,409 (GRCm39) missense unknown
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0090:Col9a1 UTSW 1 24,262,643 (GRCm39) splice site probably null
R0356:Col9a1 UTSW 1 24,224,328 (GRCm39) nonsense probably null
R0562:Col9a1 UTSW 1 24,218,360 (GRCm39) splice site probably null
R0584:Col9a1 UTSW 1 24,263,571 (GRCm39) splice site probably benign
R0708:Col9a1 UTSW 1 24,276,342 (GRCm39) missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24,262,701 (GRCm39) critical splice donor site probably null
R1445:Col9a1 UTSW 1 24,276,579 (GRCm39) critical splice donor site probably null
R1791:Col9a1 UTSW 1 24,224,386 (GRCm39) missense unknown
R1938:Col9a1 UTSW 1 24,261,554 (GRCm39) missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24,247,283 (GRCm39) missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24,218,582 (GRCm39) missense unknown
R3757:Col9a1 UTSW 1 24,271,312 (GRCm39) critical splice donor site probably null
R3891:Col9a1 UTSW 1 24,224,517 (GRCm39) critical splice donor site probably null
R4249:Col9a1 UTSW 1 24,283,462 (GRCm39) missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24,263,787 (GRCm39) splice site probably null
R4918:Col9a1 UTSW 1 24,276,339 (GRCm39) missense possibly damaging 0.74
R5144:Col9a1 UTSW 1 24,278,434 (GRCm39) missense probably benign 0.08
R5327:Col9a1 UTSW 1 24,234,620 (GRCm39) critical splice donor site probably null
R5511:Col9a1 UTSW 1 24,218,619 (GRCm39) missense unknown
R5519:Col9a1 UTSW 1 24,269,335 (GRCm39) splice site probably null
R5564:Col9a1 UTSW 1 24,234,436 (GRCm39) start gained probably benign
R6076:Col9a1 UTSW 1 24,234,457 (GRCm39) start gained probably benign
R6478:Col9a1 UTSW 1 24,224,486 (GRCm39) missense unknown
R6886:Col9a1 UTSW 1 24,224,426 (GRCm39) missense unknown
R7177:Col9a1 UTSW 1 24,234,498 (GRCm39) missense unknown
R7259:Col9a1 UTSW 1 24,224,424 (GRCm39) missense unknown
R7268:Col9a1 UTSW 1 24,246,479 (GRCm39) missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24,218,484 (GRCm39) splice site probably null
R7644:Col9a1 UTSW 1 24,224,243 (GRCm39) missense unknown
R7860:Col9a1 UTSW 1 24,276,261 (GRCm39) missense probably damaging 1.00
R8267:Col9a1 UTSW 1 24,224,267 (GRCm39) missense unknown
R8296:Col9a1 UTSW 1 24,217,380 (GRCm39) missense unknown
R8737:Col9a1 UTSW 1 24,224,127 (GRCm39) missense unknown
R8773:Col9a1 UTSW 1 24,224,208 (GRCm39) missense unknown
R8795:Col9a1 UTSW 1 24,233,812 (GRCm39) missense unknown
R8878:Col9a1 UTSW 1 24,236,048 (GRCm39) critical splice donor site probably null
R8956:Col9a1 UTSW 1 24,276,300 (GRCm39) missense probably damaging 1.00
R8978:Col9a1 UTSW 1 24,278,396 (GRCm39) missense probably damaging 1.00
R9096:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9097:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9205:Col9a1 UTSW 1 24,224,175 (GRCm39) missense unknown
R9534:Col9a1 UTSW 1 24,224,250 (GRCm39) missense unknown
Z1176:Col9a1 UTSW 1 24,253,669 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTAGCCTTTCCGCAG -3'
(R):5'- AGCCATCCGCATCAATCTGG -3'

Sequencing Primer
(F):5'- AGCACACACACAGAAAAATGG -3'
(R):5'- GCATCAATCTGGCCTCTTGG -3'
Posted On 2016-05-10