Incidental Mutation 'R5060:Gpcpd1'
ID386546
Institutional Source Beutler Lab
Gene Symbol Gpcpd1
Ensembl Gene ENSMUSG00000027346
Gene Nameglycerophosphocholine phosphodiesterase 1
Synonyms2310004G06Rik, 2310032D16Rik, Prei4
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R5060 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location132529082-132587729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132544435 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 341 (V341E)
Ref Sequence ENSEMBL: ENSMUSP00000105769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028822] [ENSMUST00000060955] [ENSMUST00000110136] [ENSMUST00000110142] [ENSMUST00000145694] [ENSMUST00000148833] [ENSMUST00000149854]
Predicted Effect probably damaging
Transcript: ENSMUST00000028822
AA Change: V157E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028822
Gene: ENSMUSG00000027346
AA Change: V157E

DomainStartEndE-ValueType
Pfam:GDPD 142 432 1.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060955
AA Change: V341E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062221
Gene: ENSMUSG00000027346
AA Change: V341E

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 5.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110136
AA Change: V157E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105763
Gene: ENSMUSG00000027346
AA Change: V157E

DomainStartEndE-ValueType
Pfam:GDPD 142 431 4.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110142
AA Change: V341E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105769
Gene: ENSMUSG00000027346
AA Change: V341E

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 6.1e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127712
Predicted Effect probably benign
Transcript: ENSMUST00000145694
SMART Domains Protein: ENSMUSP00000116457
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148833
SMART Domains Protein: ENSMUSP00000116156
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 99 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149854
SMART Domains Protein: ENSMUSP00000116949
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 94 5.54e-13 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Gpcpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Gpcpd1 APN 2 132556983 splice site probably null
IGL00672:Gpcpd1 APN 2 132530548 utr 3 prime probably benign
IGL00676:Gpcpd1 APN 2 132554011 missense probably damaging 1.00
IGL00832:Gpcpd1 APN 2 132546850 missense probably damaging 1.00
IGL00931:Gpcpd1 APN 2 132538118 missense probably benign 0.00
IGL01309:Gpcpd1 APN 2 132550324 missense probably damaging 0.97
IGL01960:Gpcpd1 APN 2 132539898 critical splice donor site probably null
IGL02110:Gpcpd1 APN 2 132530610 nonsense probably null
IGL02267:Gpcpd1 APN 2 132568710 missense probably damaging 1.00
IGL02570:Gpcpd1 APN 2 132547685 missense probably benign 0.01
IGL02588:Gpcpd1 APN 2 132534753 missense probably damaging 1.00
IGL03306:Gpcpd1 APN 2 132534073 critical splice donor site probably null
Baependi UTSW 2 132544435 missense probably damaging 1.00
R0413:Gpcpd1 UTSW 2 132564623 splice site probably benign
R1876:Gpcpd1 UTSW 2 132534753 missense probably damaging 1.00
R4276:Gpcpd1 UTSW 2 132540287 missense probably damaging 0.99
R4571:Gpcpd1 UTSW 2 132550350 missense probably benign 0.05
R4849:Gpcpd1 UTSW 2 132534099 missense probably damaging 1.00
R4930:Gpcpd1 UTSW 2 132546874 missense probably damaging 1.00
R5081:Gpcpd1 UTSW 2 132547702 missense probably benign 0.17
R5148:Gpcpd1 UTSW 2 132534190 nonsense probably null
R5189:Gpcpd1 UTSW 2 132553972 missense probably damaging 1.00
R5344:Gpcpd1 UTSW 2 132558677 intron probably benign
R5623:Gpcpd1 UTSW 2 132534717 missense probably damaging 1.00
R6086:Gpcpd1 UTSW 2 132538114 missense probably damaging 1.00
R6787:Gpcpd1 UTSW 2 132537838 intron probably benign
R6885:Gpcpd1 UTSW 2 132554074 missense possibly damaging 0.56
R7223:Gpcpd1 UTSW 2 132534056 missense probably benign 0.00
R7261:Gpcpd1 UTSW 2 132568699 missense probably damaging 0.97
R7900:Gpcpd1 UTSW 2 132534739 missense probably damaging 0.99
R7983:Gpcpd1 UTSW 2 132534739 missense probably damaging 0.99
X0018:Gpcpd1 UTSW 2 132534769 missense probably damaging 1.00
X0060:Gpcpd1 UTSW 2 132534781 missense probably damaging 1.00
X0066:Gpcpd1 UTSW 2 132544395 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCATGCGCAAGAGGTTTAAAGC -3'
(R):5'- GGTGCTTGAAATAAGTGCACATAC -3'

Sequencing Primer
(F):5'- AGTGTACAGGATCTGACACCTTCTG -3'
(R):5'- TACCAGCCAAGAGTGTTCACTATC -3'
Posted On2016-06-06