Incidental Mutation 'R5100:Mesd'
ID388218
Institutional Source Beutler Lab
Gene Symbol Mesd
Ensembl Gene ENSMUSG00000038503
Gene Namemesoderm development LRP chaperone
Synonyms2210015O11Rik, Mesdc2, msd
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.569) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location83884466-83901532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83897769 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 147 (R147C)
Ref Sequence ENSEMBL: ENSMUSP00000091768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094215] [ENSMUST00000130103]
PDB Structure
The solution structure of the core of mesoderm development (MESD). [SOLUTION NMR]
NMR solution structure of MESD [SOLUTION NMR]
MESD(12-155), The Core Structural Domain of MESD that Is Essential for Proper Folding of LRP5/6 [SOLUTION NMR]
NMR Solution Structure of Mesoderm Development (MESD) - closed conformation [SOLUTION NMR]
NMR Solution Structure of Mesoderm Development (MESD) - open conformation [SOLUTION NMR]
Structured Domain of Mus musculus Mesd [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000094215
AA Change: R147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091768
Gene: ENSMUSG00000038503
AA Change: R147C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Mesd 43 202 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130103
SMART Domains Protein: ENSMUSP00000114218
Gene: ENSMUSG00000038503

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Mesd 51 154 1.3e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138803
Predicted Effect probably benign
Transcript: ENSMUST00000153377
SMART Domains Protein: ENSMUSP00000115696
Gene: ENSMUSG00000038503

DomainStartEndE-ValueType
low complexity region 6 12 N/A INTRINSIC
Pfam:Mesd 30 51 3.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208403
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure to form the primitive stream and absence of mesodermal derivatives. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Mesd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0118:Mesd UTSW 7 83895627 missense probably damaging 1.00
R0295:Mesd UTSW 7 83897865 nonsense probably null
R0761:Mesd UTSW 7 83895743 missense probably damaging 1.00
R1465:Mesd UTSW 7 83895582 missense probably benign 0.26
R1465:Mesd UTSW 7 83895582 missense probably benign 0.26
R3894:Mesd UTSW 7 83897785 missense probably damaging 1.00
R4499:Mesd UTSW 7 83897977 missense probably benign 0.08
R4668:Mesd UTSW 7 83895756 missense probably damaging 0.99
R5783:Mesd UTSW 7 83895675 missense probably damaging 1.00
R7246:Mesd UTSW 7 83892212 unclassified probably benign
R7286:Mesd UTSW 7 83895749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCTTGATCTTAGCAGGATGC -3'
(R):5'- TGTCTTCCTTGGAAGCACGTG -3'

Sequencing Primer
(F):5'- ATGCTTGTTTAGAGCTCAGTGAAC -3'
(R):5'- AAGCACGTGGTTTGGGATCTC -3'
Posted On2016-06-06