Incidental Mutation 'R5100:Lrit1'
ID388234
Institutional Source Beutler Lab
Gene Symbol Lrit1
Ensembl Gene ENSMUSG00000041044
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 1
SynonymsLrrc21
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location37054830-37064946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37062214 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 500 (C500S)
Ref Sequence ENSEMBL: ENSMUSP00000113964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120052
AA Change: C500S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044
AA Change: C500S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic communication of cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Lrit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Lrit1 APN 14 37060155 missense probably damaging 0.98
IGL01676:Lrit1 APN 14 37057437 missense probably damaging 1.00
IGL02011:Lrit1 APN 14 37062323 missense probably damaging 1.00
PIT4142001:Lrit1 UTSW 14 37062041 missense probably damaging 1.00
R0194:Lrit1 UTSW 14 37061720 missense probably damaging 1.00
R0348:Lrit1 UTSW 14 37060225 missense probably damaging 1.00
R1444:Lrit1 UTSW 14 37061971 missense probably benign
R1500:Lrit1 UTSW 14 37062134 missense probably benign 0.23
R1884:Lrit1 UTSW 14 37061753 missense possibly damaging 0.94
R2880:Lrit1 UTSW 14 37057437 missense probably damaging 1.00
R4784:Lrit1 UTSW 14 37062236 missense possibly damaging 0.79
R4855:Lrit1 UTSW 14 37061816 missense possibly damaging 0.75
R5365:Lrit1 UTSW 14 37062142 missense probably benign 0.00
R5474:Lrit1 UTSW 14 37061986 missense probably benign
R5475:Lrit1 UTSW 14 37055001 missense probably benign 0.00
R5614:Lrit1 UTSW 14 37061954 missense probably benign 0.39
R5688:Lrit1 UTSW 14 37062428 missense possibly damaging 0.66
R5926:Lrit1 UTSW 14 37055009 missense probably damaging 1.00
R6063:Lrit1 UTSW 14 37054988 missense probably benign 0.05
R6920:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6940:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6941:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6943:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6945:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6957:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6958:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6959:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6960:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6962:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R7784:Lrit1 UTSW 14 37061780 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCACAGTGTGTCTTTGGTG -3'
(R):5'- CTTTCCAAATTAACATAGGCCCCAG -3'

Sequencing Primer
(F):5'- TGTGGAAGGCCCCTCAAG -3'
(R):5'- CACTTGTGGCAGCGTCTTCG -3'
Posted On2016-06-06