Incidental Mutation 'R4999:Creb3l1'
ID389696
Institutional Source Beutler Lab
Gene Symbol Creb3l1
Ensembl Gene ENSMUSG00000027230
Gene NamecAMP responsive element binding protein 3-like 1
SynonymsBBF-2 (drosophila) homolog, Oasis
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91982328-92024502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91983226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 489 (D489N)
Ref Sequence ENSEMBL: ENSMUSP00000028663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028663]
Predicted Effect probably benign
Transcript: ENSMUST00000028663
AA Change: D489N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028663
Gene: ENSMUSG00000027230
AA Change: D489N

DomainStartEndE-ValueType
low complexity region 49 61 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
BRLZ 288 352 8.06e-19 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is normally found in the membrane of the endoplasmic reticulum (ER). However, upon stress to the ER, the encoded protein is cleaved and the released cytoplasmic transcription factor domain translocates to the nucleus. There it activates the transcription of target genes by binding to box-B elements. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, fragile skeleton, and decreased bone density, cortical and trabecular thickness, and osteoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Creb3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Creb3l1 APN 2 92024101 missense possibly damaging 0.94
IGL01963:Creb3l1 APN 2 91993333 missense probably benign 0.00
IGL02618:Creb3l1 APN 2 91983198 missense probably benign 0.00
IGL03088:Creb3l1 APN 2 91995394 missense probably benign 0.00
R0609:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R1891:Creb3l1 UTSW 2 91987040 missense probably damaging 1.00
R2298:Creb3l1 UTSW 2 91991976 missense probably damaging 1.00
R2912:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R3084:Creb3l1 UTSW 2 91995444 splice site probably null
R3085:Creb3l1 UTSW 2 91995444 splice site probably null
R3151:Creb3l1 UTSW 2 92002033 missense probably damaging 0.96
R3945:Creb3l1 UTSW 2 91991211 missense probably damaging 1.00
R4175:Creb3l1 UTSW 2 91983175 missense probably benign 0.01
R4302:Creb3l1 UTSW 2 91993319 missense probably damaging 1.00
R5035:Creb3l1 UTSW 2 91987086 missense probably benign 0.34
R5684:Creb3l1 UTSW 2 91990731 missense probably damaging 1.00
R5750:Creb3l1 UTSW 2 91986263 missense possibly damaging 0.90
R5860:Creb3l1 UTSW 2 92024054 missense probably benign 0.00
R6144:Creb3l1 UTSW 2 91992005 missense possibly damaging 0.66
R6171:Creb3l1 UTSW 2 91991269 missense probably damaging 0.99
R6239:Creb3l1 UTSW 2 91995403 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATCCAGGGATGAATCTGCC -3'
(R):5'- AGCCTACTGTTCTACGATGATGG -3'

Sequencing Primer
(F):5'- ATGAATCTGCCCTGGGGTAC -3'
(R):5'- TCTACGATGATGGGGCAGGC -3'
Posted On2016-06-06