Mutagenetix > Incidental Mutations

Incidental Mutation 'R4999:Olfr523'

389739

Institutional Source

Beutler Lab

Gene Symbol

Olfr523

Ensembl Gene

ENSMUSG00000051051

Gene Name

olfactory receptor 523

Synonyms

MOR104-4, GA_x6K02T2PBJ9-42327937-42328872

MMRRC Submission

042593-MU

Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R4999 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140173217-140178758 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140177020 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 300 (V300A)

Ref Sequence

ENSEMBL: ENSMUSP00000149562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055890
AA Change: V306A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: V306A

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:7tm_4	40	317	1.6e-50	PFAM
Pfam:7tm_1	50	299	1.6e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209314
AA Change: V300A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213953
AA Change: V300A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214272
AA Change: V300A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215785
AA Change: V300A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216023
AA Change: V300A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	A	G	1: 16,068,798		probably null	Het
Abca4	T	A	3: 122,105,370	V667D	probably damaging	Het
Aco1	A	G	4: 40,176,507	I224V	probably damaging	Het
Arel1	C	T	12: 84,931,767	V364M	probably damaging	Het
Arhgap42	A	G	9: 9,009,434	V484A	probably damaging	Het
Asap2	T	C	12: 21,252,765	F681L	probably benign	Het
Atrn	C	A	2: 130,975,954	D809E	probably damaging	Het
BC037034	T	A	5: 138,261,622	T391S	probably damaging	Het
Ccdc70	G	A	8: 21,973,250	V19M	possibly damaging	Het
Ccp110	G	T	7: 118,730,012	E73*	probably null	Het
Cfap57	A	C	4: 118,595,848	S553A	probably benign	Het
Cftr	A	G	6: 18,221,614	K212E	probably benign	Het
Chkb	A	T	15: 89,428,165	Y216N	probably damaging	Het
Cntnap2	G	T	6: 45,920,834	D149Y	probably damaging	Het
Cpd	A	G	11: 76,846,222		probably null	Het
Creb3l1	C	T	2: 91,983,226	D489N	probably benign	Het
Crhbp	A	G	13: 95,442,245	F123L	probably damaging	Het
Cryab	T	C	9: 50,754,609	V100A	possibly damaging	Het
Csmd2	T	C	4: 128,521,930	I2684T	probably benign	Het
Ctbp2	G	T	7: 133,014,649	P186T	possibly damaging	Het
Ctnna2	T	C	6: 76,915,762	N814S	possibly damaging	Het
Dntt	T	C	19: 41,039,856	V197A	probably damaging	Het
Fam135a	G	A	1: 24,020,677	A1187V	possibly damaging	Het
Filip1l	A	T	16: 57,570,415	Q455H	probably benign	Het
Grm2	T	C	9: 106,653,990	E100G	probably damaging	Het
Gtf2ird2	G	A	5: 134,217,464	V855M	probably damaging	Het
Heatr9	A	T	11: 83,518,792	I118N	possibly damaging	Het
Htra3	T	C	5: 35,671,125	H137R	probably benign	Het
Iars	A	G	13: 49,709,661	S530G	probably damaging	Het
Klhdc4	T	A	8: 121,796,603	M510L	probably benign	Het
Lipc	T	C	9: 70,816,731	T204A	probably benign	Het
Lrp1	A	G	10: 127,553,779	V3129A	probably damaging	Het
Macf1	G	A	4: 123,494,909	T1120I	probably benign	Het
Map4	T	C	9: 110,038,377		probably benign	Het
Mbtps1	A	T	8: 119,533,348	V420D	probably damaging	Het
Mta2	G	T	19: 8,950,383	D523Y	probably benign	Het
Muc4	A	G	16: 32,756,296		probably benign	Het
Mug1	C	T	6: 121,878,943	Q965*	probably null	Het
Myo1e	T	A	9: 70,353,312	I584N	probably damaging	Het
Nolc1	T	C	19: 46,078,920	V80A	probably damaging	Het
Nop56	G	T	2: 130,275,725	V91L	probably benign	Het
Olfr1451	A	T	19: 12,999,219	M78L	probably benign	Het
Olfr191	A	T	16: 59,086,402	L27Q	probably damaging	Het
Osbpl3	T	C	6: 50,336,297	E107G	probably damaging	Het
Pde3a	T	A	6: 141,250,025	C146S	probably benign	Het
Pfkm	A	G	15: 98,128,242	M573V	probably damaging	Het
Pkd1l2	C	T	8: 117,047,374		probably null	Het
Plekhg3	T	C	12: 76,565,247	I374T	possibly damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Prom1	T	G	5: 44,037,534	I290L	probably benign	Het
Rufy3	T	A	5: 88,637,226	M387K	probably damaging	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	T	A	5: 12,508,087		probably null	Het
Sema6c	C	T	3: 95,168,363	T175I	probably damaging	Het
Serpina3k	T	C	12: 104,341,046	I179T	probably damaging	Het
Sf3b3	T	C	8: 110,841,203	T207A	probably benign	Het
Slc22a26	C	A	19: 7,802,181	R90L	probably damaging	Het
Slitrk5	T	C	14: 111,680,216	V424A	probably damaging	Het
Smarca2	G	T	19: 26,720,855	E89*	probably null	Het
Soga1	C	T	2: 157,022,856	G1144D	probably benign	Het
Stab2	T	A	10: 86,937,909	S853C	probably damaging	Het
Stk17b	A	T	1: 53,761,147		probably null	Het
Taar5	T	A	10: 23,971,547	I281N	possibly damaging	Het
Tarsl2	A	T	7: 65,658,935	E284D	probably damaging	Het
Tbx15	C	A	3: 99,316,333	T279K	probably damaging	Het
Tfr2	G	A	5: 137,586,925	V740I	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tmem145	A	G	7: 25,309,034	T302A	probably benign	Het
Tmem57	A	G	4: 134,828,133	I343T	probably benign	Het
Trpa1	G	T	1: 14,875,861	H1015Q	probably benign	Het
Tspan8	A	G	10: 115,817,629	Y10C	possibly damaging	Het
Ttll7	A	G	3: 146,894,469	N44S	probably damaging	Het
Uba7	T	C	9: 107,979,839		probably null	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr5	C	A	15: 38,009,668	A1022S	probably benign	Het
Usf1	T	G	1: 171,415,763	I36S	probably damaging	Het
Vmn1r181	A	T	7: 23,984,365	D85V	probably damaging	Het
Vmn1r3	A	T	4: 3,185,009	Y99*	probably null	Het
Vmn1r72	T	C	7: 11,670,373	I49M	possibly damaging	Het
Vmn2r99	A	G	17: 19,362,135	M1V	probably null	Het
Vsig10	T	A	5: 117,343,975	V410E	probably damaging	Het
Zc3h7b	A	G	15: 81,779,133	Y442C	probably damaging	Het
Zfyve26	G	T	12: 79,280,385	Y730*	probably null	Het

Other mutations in Olfr523

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01288:Olfr523	APN	7	140176615	missense	probably damaging	1.00
IGL01759:Olfr523	APN	7	140176534	missense	probably benign	0.00
D3080:Olfr523	UTSW	7	140176362	missense	possibly damaging	0.94
R0503:Olfr523	UTSW	7	140176441	missense	possibly damaging	0.95
R1644:Olfr523	UTSW	7	140176648	missense	probably benign	0.12
R1760:Olfr523	UTSW	7	140176275	missense	probably damaging	1.00
R1852:Olfr523	UTSW	7	140176561	nonsense	probably null
R1960:Olfr523	UTSW	7	140176683	missense	probably benign	0.37
R2363:Olfr523	UTSW	7	140176965	missense	probably damaging	1.00
R3700:Olfr523	UTSW	7	140176214	missense	possibly damaging	0.54
R4626:Olfr523	UTSW	7	140176446	missense	probably damaging	1.00
R4678:Olfr523	UTSW	7	140176228	missense	probably benign	0.21
R4779:Olfr523	UTSW	7	140176450	missense	probably damaging	1.00
R5663:Olfr523	UTSW	7	140176321	missense	probably damaging	1.00
R7352:Olfr523	UTSW	7	140176525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAAGATTCCCTCTGCCCAGG -3'
(R):5'- TGGAACAACAAGCACTCCTG -3'

Sequencing Primer
(F):5'- GCACCGCGCCTTCTCTAC -3'
(R):5'- AGCACTCCTGAACAAAGCC -3'

Posted On

2016-06-06