Mutagenetix > Incidental Mutation

Incidental Mutation 'R4999:Asap2'

389757

Institutional Source

Beutler Lab

Gene Symbol

Asap2

Ensembl Gene

ENSMUSG00000052632

Gene Name

ArfGAP with SH3 domain, ankyrin repeat and PH domain 2

Synonyms

6530401G17Rik, LOC385250, Ddef2

MMRRC Submission

042593-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R4999 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20990459-21270171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21252765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 681 (F681L)

Ref Sequence

ENSEMBL: ENSMUSP00000054631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]

AlphaFold

Q7SIG6

Predicted Effect

probably benign
Transcript: ENSMUST00000050990
AA Change: F681L

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: F681L

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
SH3	896	954	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000064595
AA Change: F681L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: F681L

Domain	Start	End	E-Value	Type
Pfam:BAR	11	247	2.4e-9	PFAM
Pfam:BAR_3	31	265	3.3e-28	PFAM
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	837	849	N/A	INTRINSIC
low complexity region	872	892	N/A	INTRINSIC
SH3	941	999	4.28e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000090834
AA Change: F535L

SMART Domains

Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: F535L

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
Blast:PH	196	318	1e-50	BLAST
Blast:ArfGap	334	395	5e-30	BLAST
ANK	438	470	6.17e-1	SMART
ANK	474	503	4.03e-5	SMART
ANK	507	537	1.48e3	SMART
low complexity region	547	561	N/A	INTRINSIC
low complexity region	619	643	N/A	INTRINSIC
low complexity region	681	701	N/A	INTRINSIC
SH3	750	808	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101562
AA Change: F684L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: F684L

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	309	402	2.31e-18	SMART
ArfGap	424	544	6.82e-27	SMART
ANK	587	619	6.17e-1	SMART
ANK	623	652	4.03e-5	SMART
ANK	656	686	1.48e3	SMART
low complexity region	696	710	N/A	INTRINSIC
low complexity region	768	792	N/A	INTRINSIC
low complexity region	830	850	N/A	INTRINSIC
SH3	899	957	4.28e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173157

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	A	G	1: 16,068,798		probably null	Het
Abca4	T	A	3: 122,105,370	V667D	probably damaging	Het
Aco1	A	G	4: 40,176,507	I224V	probably damaging	Het
Arel1	C	T	12: 84,931,767	V364M	probably damaging	Het
Arhgap42	A	G	9: 9,009,434	V484A	probably damaging	Het
Atrn	C	A	2: 130,975,954	D809E	probably damaging	Het
BC037034	T	A	5: 138,261,622	T391S	probably damaging	Het
Ccdc70	G	A	8: 21,973,250	V19M	possibly damaging	Het
Ccp110	G	T	7: 118,730,012	E73*	probably null	Het
Cfap57	A	C	4: 118,595,848	S553A	probably benign	Het
Cftr	A	G	6: 18,221,614	K212E	probably benign	Het
Chkb	A	T	15: 89,428,165	Y216N	probably damaging	Het
Cntnap2	G	T	6: 45,920,834	D149Y	probably damaging	Het
Cpd	A	G	11: 76,846,222		probably null	Het
Creb3l1	C	T	2: 91,983,226	D489N	probably benign	Het
Crhbp	A	G	13: 95,442,245	F123L	probably damaging	Het
Cryab	T	C	9: 50,754,609	V100A	possibly damaging	Het
Csmd2	T	C	4: 128,521,930	I2684T	probably benign	Het
Ctbp2	G	T	7: 133,014,649	P186T	possibly damaging	Het
Ctnna2	T	C	6: 76,915,762	N814S	possibly damaging	Het
Dntt	T	C	19: 41,039,856	V197A	probably damaging	Het
Fam135a	G	A	1: 24,020,677	A1187V	possibly damaging	Het
Filip1l	A	T	16: 57,570,415	Q455H	probably benign	Het
Grm2	T	C	9: 106,653,990	E100G	probably damaging	Het
Gtf2ird2	G	A	5: 134,217,464	V855M	probably damaging	Het
Heatr9	A	T	11: 83,518,792	I118N	possibly damaging	Het
Htra3	T	C	5: 35,671,125	H137R	probably benign	Het
Iars	A	G	13: 49,709,661	S530G	probably damaging	Het
Klhdc4	T	A	8: 121,796,603	M510L	probably benign	Het
Lipc	T	C	9: 70,816,731	T204A	probably benign	Het
Lrp1	A	G	10: 127,553,779	V3129A	probably damaging	Het
Macf1	G	A	4: 123,494,909	T1120I	probably benign	Het
Map4	T	C	9: 110,038,377		probably benign	Het
Mbtps1	A	T	8: 119,533,348	V420D	probably damaging	Het
Mta2	G	T	19: 8,950,383	D523Y	probably benign	Het
Muc4	A	G	16: 32,756,296		probably benign	Het
Mug1	C	T	6: 121,878,943	Q965*	probably null	Het
Myo1e	T	A	9: 70,353,312	I584N	probably damaging	Het
Nolc1	T	C	19: 46,078,920	V80A	probably damaging	Het
Nop56	G	T	2: 130,275,725	V91L	probably benign	Het
Olfr1451	A	T	19: 12,999,219	M78L	probably benign	Het
Olfr191	A	T	16: 59,086,402	L27Q	probably damaging	Het
Olfr523	T	C	7: 140,177,020	V300A	probably damaging	Het
Osbpl3	T	C	6: 50,336,297	E107G	probably damaging	Het
Pde3a	T	A	6: 141,250,025	C146S	probably benign	Het
Pfkm	A	G	15: 98,128,242	M573V	probably damaging	Het
Pkd1l2	C	T	8: 117,047,374		probably null	Het
Plekhg3	T	C	12: 76,565,247	I374T	possibly damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Prom1	T	G	5: 44,037,534	I290L	probably benign	Het
Rufy3	T	A	5: 88,637,226	M387K	probably damaging	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	T	A	5: 12,508,087		probably null	Het
Sema6c	C	T	3: 95,168,363	T175I	probably damaging	Het
Serpina3k	T	C	12: 104,341,046	I179T	probably damaging	Het
Sf3b3	T	C	8: 110,841,203	T207A	probably benign	Het
Slc22a26	C	A	19: 7,802,181	R90L	probably damaging	Het
Slitrk5	T	C	14: 111,680,216	V424A	probably damaging	Het
Smarca2	G	T	19: 26,720,855	E89*	probably null	Het
Soga1	C	T	2: 157,022,856	G1144D	probably benign	Het
Stab2	T	A	10: 86,937,909	S853C	probably damaging	Het
Stk17b	A	T	1: 53,761,147		probably null	Het
Taar5	T	A	10: 23,971,547	I281N	possibly damaging	Het
Tarsl2	A	T	7: 65,658,935	E284D	probably damaging	Het
Tbx15	C	A	3: 99,316,333	T279K	probably damaging	Het
Tfr2	G	A	5: 137,586,925	V740I	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tmem145	A	G	7: 25,309,034	T302A	probably benign	Het
Tmem57	A	G	4: 134,828,133	I343T	probably benign	Het
Trpa1	G	T	1: 14,875,861	H1015Q	probably benign	Het
Tspan8	A	G	10: 115,817,629	Y10C	possibly damaging	Het
Ttll7	A	G	3: 146,894,469	N44S	probably damaging	Het
Uba7	T	C	9: 107,979,839		probably null	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr5	C	A	15: 38,009,668	A1022S	probably benign	Het
Usf1	T	G	1: 171,415,763	I36S	probably damaging	Het
Vmn1r181	A	T	7: 23,984,365	D85V	probably damaging	Het
Vmn1r3	A	T	4: 3,185,009	Y99*	probably null	Het
Vmn1r72	T	C	7: 11,670,373	I49M	possibly damaging	Het
Vmn2r99	A	G	17: 19,362,135	M1V	probably null	Het
Vsig10	T	A	5: 117,343,975	V410E	probably damaging	Het
Zc3h7b	A	G	15: 81,779,133	Y442C	probably damaging	Het
Zfyve26	G	T	12: 79,280,385	Y730*	probably null	Het

Other mutations in Asap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Asap2	APN	12	21239648	missense	possibly damaging	0.66
IGL01140:Asap2	APN	12	21206316	missense	probably damaging	1.00
IGL01285:Asap2	APN	12	21229263	missense	probably damaging	1.00
IGL01318:Asap2	APN	12	21247295	missense	probably null	0.00
IGL01355:Asap2	APN	12	21218086	splice site	probably benign
IGL01593:Asap2	APN	12	21213202	missense	probably null	0.03
IGL01705:Asap2	APN	12	21249368	missense	possibly damaging	0.85
IGL01716:Asap2	APN	12	21254306	missense	possibly damaging	0.94
IGL02822:Asap2	APN	12	21265910	missense	probably damaging	1.00
IGL02876:Asap2	APN	12	21258163	missense	probably benign	0.00
IGL02991:Asap2	APN	12	21249293	splice site	probably benign
R0157:Asap2	UTSW	12	21206325	missense	probably damaging	1.00
R0399:Asap2	UTSW	12	21217997	missense	possibly damaging	0.90
R0472:Asap2	UTSW	12	21213185	missense	possibly damaging	0.47
R0959:Asap2	UTSW	12	21247319	missense	probably damaging	1.00
R0981:Asap2	UTSW	12	21265960	missense	probably damaging	0.98
R1141:Asap2	UTSW	12	21185110	missense	probably damaging	1.00
R1382:Asap2	UTSW	12	21265954	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239585	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239589	missense	probably damaging	1.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1526:Asap2	UTSW	12	21185187	missense	probably damaging	1.00
R1542:Asap2	UTSW	12	21265997	missense	probably damaging	1.00
R1710:Asap2	UTSW	12	21224392	missense	probably damaging	1.00
R1750:Asap2	UTSW	12	21203998	missense	probably damaging	1.00
R2151:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2152:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2154:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2323:Asap2	UTSW	12	21203968	missense	probably damaging	1.00
R2378:Asap2	UTSW	12	21254318	missense	possibly damaging	0.95
R3151:Asap2	UTSW	12	21224377	missense	probably damaging	1.00
R3757:Asap2	UTSW	12	21267766	missense	probably damaging	1.00
R4305:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4307:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4308:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4345:Asap2	UTSW	12	21230831	missense	probably damaging	1.00
R4525:Asap2	UTSW	12	21229292	splice site	probably null
R4562:Asap2	UTSW	12	21112093	missense	probably damaging	1.00
R5027:Asap2	UTSW	12	21204081	missense	probably damaging	1.00
R5221:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R5645:Asap2	UTSW	12	21265982	missense	probably damaging	0.99
R5799:Asap2	UTSW	12	21168246	missense	probably damaging	1.00
R5876:Asap2	UTSW	12	21212809	missense	possibly damaging	0.88
R5888:Asap2	UTSW	12	21218190	missense	probably damaging	1.00
R5912:Asap2	UTSW	12	21206343	missense	probably damaging	1.00
R6576:Asap2	UTSW	12	21244703	missense	probably damaging	1.00
R6896:Asap2	UTSW	12	21265525	missense	probably damaging	1.00
R6934:Asap2	UTSW	12	21168250	missense	probably damaging	1.00
R7134:Asap2	UTSW	12	21265963	nonsense	probably null
R7347:Asap2	UTSW	12	21229457	missense	probably benign	0.03
R7378:Asap2	UTSW	12	21112051	missense	probably benign	0.01
R7515:Asap2	UTSW	12	21229239	missense	possibly damaging	0.76
R8033:Asap2	UTSW	12	21224389	missense	probably damaging	1.00
R8793:Asap2	UTSW	12	21168211	missense	probably damaging	1.00
R8891:Asap2	UTSW	12	21112143	missense	probably damaging	1.00
R8972:Asap2	UTSW	12	21229248	missense	probably damaging	1.00
R9021:Asap2	UTSW	12	21203998	missense	possibly damaging	0.94
R9216:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R9323:Asap2	UTSW	12	21112147	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTAAGTGAGCTGCCCTGG -3'
(R):5'- TAAACACTGTCACCTGCCAG -3'

Sequencing Primer
(F):5'- TGGGACAGAAGGGAATCTCCTTG -3'
(R):5'- CACATGGCAGCATGGACTG -3'

Posted On

2016-06-06