Incidental Mutation 'R5006:Vmn1r235'
ID 390179
Institutional Source Beutler Lab
Gene Symbol Vmn1r235
Ensembl Gene ENSMUSG00000050102
Gene Name vomeronasal 1 receptor 235
Synonyms V1rf2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 21260427-21262863 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21262205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 264 (M264T)
Ref Sequence ENSEMBL: ENSMUSP00000061689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060603]
AlphaFold A0A494B9T5
Predicted Effect probably benign
Transcript: ENSMUST00000060603
AA Change: M264T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000061689
Gene: ENSMUSG00000050102
AA Change: M264T

DomainStartEndE-ValueType
Pfam:V1R 52 322 2.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Vmn1r235
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0138:Vmn1r235 UTSW 17 21262334 missense probably damaging 1.00
R0149:Vmn1r235 UTSW 17 21261995 missense probably damaging 0.99
R1780:Vmn1r235 UTSW 17 21261737 missense probably benign 0.01
R1918:Vmn1r235 UTSW 17 21262397 missense possibly damaging 0.63
R1944:Vmn1r235 UTSW 17 21261523 missense probably damaging 1.00
R2151:Vmn1r235 UTSW 17 21262366 missense probably benign 0.33
R4296:Vmn1r235 UTSW 17 21262300 missense probably damaging 1.00
R4408:Vmn1r235 UTSW 17 21261592 missense probably damaging 0.98
R4689:Vmn1r235 UTSW 17 21262361 missense probably benign 0.34
R5033:Vmn1r235 UTSW 17 21262288 missense possibly damaging 0.74
R5303:Vmn1r235 UTSW 17 21262006 missense probably benign 0.05
R5512:Vmn1r235 UTSW 17 21261415 start codon destroyed probably benign 0.09
R6999:Vmn1r235 UTSW 17 21261865 missense probably benign 0.04
R7133:Vmn1r235 UTSW 17 21262030 missense probably benign 0.01
R7471:Vmn1r235 UTSW 17 21262396 missense probably benign 0.07
R7552:Vmn1r235 UTSW 17 21261451 missense probably benign 0.01
R7577:Vmn1r235 UTSW 17 21261619 missense possibly damaging 0.54
R8716:Vmn1r235 UTSW 17 21262292 missense possibly damaging 0.49
R8725:Vmn1r235 UTSW 17 21261794 missense probably damaging 1.00
R8727:Vmn1r235 UTSW 17 21261794 missense probably damaging 1.00
R8729:Vmn1r235 UTSW 17 21261613 missense probably benign 0.00
R8732:Vmn1r235 UTSW 17 21262177 missense probably damaging 0.98
R9016:Vmn1r235 UTSW 17 21261707 missense possibly damaging 0.94
R9072:Vmn1r235 UTSW 17 21262009 missense probably benign 0.03
R9350:Vmn1r235 UTSW 17 21261928 missense probably benign 0.17
R9633:Vmn1r235 UTSW 17 21262067 missense probably benign 0.40
R9633:Vmn1r235 UTSW 17 21262068 missense possibly damaging 0.46
R9712:Vmn1r235 UTSW 17 21261698 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCTCTGTTTGTCTTGACAAAACTG -3'
(R):5'- CTCATGCAAGGAACACAGTGG -3'

Sequencing Primer
(F):5'- GTCTTGACAAAACTGGACAAATCCTG -3'
(R):5'- CACAGTGGCTAGATGCTATGG -3'
Posted On 2016-06-06