Incidental Mutation 'IGL02835:Angptl1'
ID391950
Institutional Source Beutler Lab
Gene Symbol Angptl1
Ensembl Gene ENSMUSG00000033544
Gene Nameangiopoietin-like 1
SynonymsANGPT3, ANG-3, ANG3, 2810039D03Rik, ANGY, ARP1, ANG3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #IGL02835 (G1)
Quality Score129
Status Validated
Chromosome1
Chromosomal Location156838562-156861078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156858520 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 392 (D392G)
Ref Sequence ENSEMBL: ENSMUSP00000027885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027885] [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably benign
Transcript: ENSMUST00000027885
AA Change: D392G

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027885
Gene: ENSMUSG00000033544
AA Change: D392G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FBG 274 489 1.3e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027886
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063199
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171292
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172057
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185198
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188656
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189316
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190648
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191605
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no detectable phenotypic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A530016L24Rik A C 12: 112,494,986 probably null Het
A830018L16Rik A C 1: 11,972,055 D433A possibly damaging Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Hyal4 G A 6: 24,765,715 R356H probably benign Het
Il22ra2 C A 10: 19,626,676 T81K probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Nup155 T C 15: 8,143,130 Y867H probably damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in Angptl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0285:Angptl1 UTSW 1 156845215 missense probably benign 0.00
R1237:Angptl1 UTSW 1 156858584 missense probably damaging 1.00
R1573:Angptl1 UTSW 1 156857170 missense possibly damaging 0.81
R1722:Angptl1 UTSW 1 156857085 missense possibly damaging 0.87
R4621:Angptl1 UTSW 1 156844924 missense probably damaging 1.00
R4795:Angptl1 UTSW 1 156860583 missense possibly damaging 0.88
R4849:Angptl1 UTSW 1 156857165 missense probably benign 0.01
R4915:Angptl1 UTSW 1 156844818 missense probably benign
R5919:Angptl1 UTSW 1 156858546 missense probably damaging 1.00
R6656:Angptl1 UTSW 1 156857236 missense probably damaging 1.00
R6833:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R6834:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R7453:Angptl1 UTSW 1 156844851 missense probably benign 0.06
R7657:Angptl1 UTSW 1 156857220 missense probably benign 0.01
R7692:Angptl1 UTSW 1 156845315 missense probably damaging 1.00
RF002:Angptl1 UTSW 1 156857224 missense possibly damaging 0.79
X0066:Angptl1 UTSW 1 156844935 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACAATATCCTCACTCTGCTC -3'
(R):5'- ACCCTTTGTGAGATTGAGGGC -3'

Sequencing Primer
(F):5'- ACCAATATGTTCATGTGTCTGTG -3'
(R):5'- CCTGGTTCTGTTTAATGTGTAGCAC -3'
Posted On2016-06-08