Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL02835:Nin'

391993

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

IGL02835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70056738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 243 (F243I)

Ref Sequence

ENSEMBL: ENSMUSP00000152350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably damaging
Transcript: ENSMUST00000021468
AA Change: F243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: F243I

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085314
AA Change: F243I

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: F243I

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095666
AA Change: F243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: F243I

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169074
AA Change: F243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: F243I

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220689
AA Change: F243I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221141

Predicted Effect

probably benign
Transcript: ENSMUST00000221275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222237
AA Change: F243I

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222835
AA Change: F243I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: F243I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1575

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	A	8: 79,210,655	K208*	probably null	Het
A530016L24Rik	A	C	12: 112,494,986		probably null	Het
A830018L16Rik	A	C	1: 11,972,055	D433A	possibly damaging	Het
Abca13	T	A	11: 9,451,515	I3985N	probably damaging	Het
Abhd17c	C	T	7: 84,151,523	D108N	probably benign	Het
Adam29	C	T	8: 55,873,138	D94N	probably damaging	Het
Agr2	A	G	12: 35,995,904	D50G	probably benign	Het
Akap2	C	G	4: 57,883,044	P837A	probably damaging	Het
Angptl1	A	G	1: 156,858,520	D392G	probably benign	Het
Apob	A	G	12: 8,015,097	N3989S	possibly damaging	Het
AU018091	T	C	7: 3,169,071	D12G	unknown	Het
Cyfip2	A	T	11: 46,249,771	S742T	probably benign	Het
Dlc1	C	T	8: 36,583,901	S892N	probably damaging	Het
Dsg1b	A	G	18: 20,392,014	N169S	possibly damaging	Het
Egfem1	T	C	3: 29,657,241	L323P	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Fjx1	G	A	2: 102,450,747	A281V	possibly damaging	Het
Fmn2	T	A	1: 174,582,059	D619E	unknown	Het
Gm13088	T	A	4: 143,654,247	Y402F	probably damaging	Het
Gm4795	A	C	10: 45,006,158		noncoding transcript	Het
Gm5117	T	C	8: 31,737,170		noncoding transcript	Het
Gm5250	T	C	1: 13,062,194		noncoding transcript	Het
Gtdc1	A	T	2: 44,756,312	Y101*	probably null	Het
Herc6	T	C	6: 57,646,161	I583T	possibly damaging	Het
Hyal4	G	A	6: 24,765,715	R356H	probably benign	Het
Il22ra2	C	A	10: 19,626,676	T81K	probably benign	Het
Iqcm	T	A	8: 75,554,883		probably benign	Het
Izumo4	G	A	10: 80,705,125	V220I	probably benign	Het
Kif16b	A	T	2: 142,712,213	D899E	probably benign	Het
Lrp2	A	T	2: 69,505,304	N1358K	probably damaging	Het
Lrrk2	A	G	15: 91,814,660		probably null	Het
Lyst	C	T	13: 13,661,100	T1789M	possibly damaging	Het
Map4k4	A	G	1: 40,010,600	T732A	probably damaging	Het
Mdh1b	A	T	1: 63,718,657	I305N	probably damaging	Het
Mettl13	A	G	1: 162,546,016	I222T	probably damaging	Het
Muc4	T	C	16: 32,763,945	F2583L	probably benign	Het
Nbea	C	T	3: 55,717,869	R2267Q	possibly damaging	Het
Ndfip1	T	C	18: 38,456,091	Y178H	probably damaging	Het
Nlrp10	A	T	7: 108,924,662	I537K	possibly damaging	Het
Nup155	T	C	15: 8,143,130	Y867H	probably damaging	Het
Pik3r4	A	C	9: 105,672,706	I999L	probably benign	Het
Pitpnm3	G	A	11: 72,061,466		probably benign	Het
Pkd1l2	G	A	8: 117,065,745	T436I	probably benign	Het
Polg2	A	T	11: 106,775,440	V293E	probably benign	Het
Prok1	T	C	3: 107,237,215		probably null	Het
Ptcd1	T	C	5: 145,154,690	D533G	possibly damaging	Het
Ptpn13	T	C	5: 103,560,025	V1484A	probably damaging	Het
Rapgef2	A	T	3: 79,092,986		probably benign	Het
Serpinb8	T	G	1: 107,602,856	F121L	probably damaging	Het
Sh3rf1	T	A	8: 61,226,047	V41E	probably damaging	Het
Snx13	A	G	12: 35,132,127	N725S	possibly damaging	Het
Soga1	G	A	2: 157,041,934	T363I	possibly damaging	Het
Stab1	A	T	14: 31,146,024		probably null	Het
Themis	A	T	10: 28,761,620		probably benign	Het
Trim68	T	A	7: 102,678,573	Y391F	probably benign	Het
Trmt1	T	G	8: 84,696,960	V327G	probably null	Het
Vill	C	T	9: 119,067,445	T120M	probably benign	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- AAAGAAAATGTTCTGTTGGTGCCTC -3'
(R):5'- ACAACATTATGTGTCTGGGCTTTTG -3'

Sequencing Primer
(F):5'- CTAAGACAGGGTCTCGCTATGTAGC -3'
(R):5'- GGAGTAGCAGGGGTATGAATTTC -3'

Posted On

2016-06-08