Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL02835:Nlrp10'

391973

Institutional Source

Beutler Lab

Gene Symbol

Nlrp10

Ensembl Gene

ENSMUSG00000049709

Gene Name

NLR family, pyrin domain containing 10

Synonyms

Nalp10, 6430548I20Rik, Pynod

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

IGL02835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108921852-108930178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108924662 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 537 (I537K)

Ref Sequence

ENSEMBL: ENSMUSP00000050252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055745]

PDB Structure

Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055745
AA Change: I537K

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: I537K

Domain	Start	End	E-Value	Type
PYRIN	9	88	4.13e-18	SMART
low complexity region	126	137	N/A	INTRINSIC
AAA	161	302	1.07e-2	SMART
low complexity region	576	597	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	A	8: 79,210,655	K208*	probably null	Het
A530016L24Rik	A	C	12: 112,494,986		probably null	Het
A830018L16Rik	A	C	1: 11,972,055	D433A	possibly damaging	Het
Abca13	T	A	11: 9,451,515	I3985N	probably damaging	Het
Abhd17c	C	T	7: 84,151,523	D108N	probably benign	Het
Adam29	C	T	8: 55,873,138	D94N	probably damaging	Het
Agr2	A	G	12: 35,995,904	D50G	probably benign	Het
Akap2	C	G	4: 57,883,044	P837A	probably damaging	Het
Angptl1	A	G	1: 156,858,520	D392G	probably benign	Het
Apob	A	G	12: 8,015,097	N3989S	possibly damaging	Het
AU018091	T	C	7: 3,169,071	D12G	unknown	Het
Cyfip2	A	T	11: 46,249,771	S742T	probably benign	Het
Dlc1	C	T	8: 36,583,901	S892N	probably damaging	Het
Dsg1b	A	G	18: 20,392,014	N169S	possibly damaging	Het
Egfem1	T	C	3: 29,657,241	L323P	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Fjx1	G	A	2: 102,450,747	A281V	possibly damaging	Het
Fmn2	T	A	1: 174,582,059	D619E	unknown	Het
Gm13088	T	A	4: 143,654,247	Y402F	probably damaging	Het
Gm4795	A	C	10: 45,006,158		noncoding transcript	Het
Gm5117	T	C	8: 31,737,170		noncoding transcript	Het
Gm5250	T	C	1: 13,062,194		noncoding transcript	Het
Gtdc1	A	T	2: 44,756,312	Y101*	probably null	Het
Herc6	T	C	6: 57,646,161	I583T	possibly damaging	Het
Hyal4	G	A	6: 24,765,715	R356H	probably benign	Het
Il22ra2	C	A	10: 19,626,676	T81K	probably benign	Het
Iqcm	T	A	8: 75,554,883		probably benign	Het
Izumo4	G	A	10: 80,705,125	V220I	probably benign	Het
Kif16b	A	T	2: 142,712,213	D899E	probably benign	Het
Lrp2	A	T	2: 69,505,304	N1358K	probably damaging	Het
Lrrk2	A	G	15: 91,814,660		probably null	Het
Lyst	C	T	13: 13,661,100	T1789M	possibly damaging	Het
Map4k4	A	G	1: 40,010,600	T732A	probably damaging	Het
Mdh1b	A	T	1: 63,718,657	I305N	probably damaging	Het
Mettl13	A	G	1: 162,546,016	I222T	probably damaging	Het
Muc4	T	C	16: 32,763,945	F2583L	probably benign	Het
Nbea	C	T	3: 55,717,869	R2267Q	possibly damaging	Het
Ndfip1	T	C	18: 38,456,091	Y178H	probably damaging	Het
Nin	A	T	12: 70,056,738	F243I	probably damaging	Het
Nup155	T	C	15: 8,143,130	Y867H	probably damaging	Het
Pik3r4	A	C	9: 105,672,706	I999L	probably benign	Het
Pitpnm3	G	A	11: 72,061,466		probably benign	Het
Pkd1l2	G	A	8: 117,065,745	T436I	probably benign	Het
Polg2	A	T	11: 106,775,440	V293E	probably benign	Het
Prok1	T	C	3: 107,237,215		probably null	Het
Ptcd1	T	C	5: 145,154,690	D533G	possibly damaging	Het
Ptpn13	T	C	5: 103,560,025	V1484A	probably damaging	Het
Rapgef2	A	T	3: 79,092,986		probably benign	Het
Serpinb8	T	G	1: 107,602,856	F121L	probably damaging	Het
Sh3rf1	T	A	8: 61,226,047	V41E	probably damaging	Het
Snx13	A	G	12: 35,132,127	N725S	possibly damaging	Het
Soga1	G	A	2: 157,041,934	T363I	possibly damaging	Het
Stab1	A	T	14: 31,146,024		probably null	Het
Themis	A	T	10: 28,761,620		probably benign	Het
Trim68	T	A	7: 102,678,573	Y391F	probably benign	Het
Trmt1	T	G	8: 84,696,960	V327G	probably null	Het
Vill	C	T	9: 119,067,445	T120M	probably benign	Het

Other mutations in Nlrp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Nlrp10	APN	7	108924581	missense	possibly damaging	0.86
IGL01482:Nlrp10	APN	7	108926952	missense	probably benign
IGL02043:Nlrp10	APN	7	108925502	missense	probably damaging	0.99
IGL03129:Nlrp10	APN	7	108924911	missense	probably damaging	1.00
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0540:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R0607:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R1166:Nlrp10	UTSW	7	108925010	missense	probably damaging	1.00
R1248:Nlrp10	UTSW	7	108925881	missense	probably benign	0.08
R1450:Nlrp10	UTSW	7	108925388	missense	probably damaging	0.98
R1459:Nlrp10	UTSW	7	108924348	missense	probably benign
R1567:Nlrp10	UTSW	7	108927050	missense	probably benign	0.02
R1635:Nlrp10	UTSW	7	108924530	missense	possibly damaging	0.93
R1845:Nlrp10	UTSW	7	108927041	missense	probably damaging	1.00
R1912:Nlrp10	UTSW	7	108925395	nonsense	probably null
R1952:Nlrp10	UTSW	7	108924563	missense	probably benign	0.20
R1953:Nlrp10	UTSW	7	108925118	missense	probably benign	0.00
R2079:Nlrp10	UTSW	7	108925628	missense	possibly damaging	0.66
R3615:Nlrp10	UTSW	7	108924476	missense	probably benign
R3616:Nlrp10	UTSW	7	108924476	missense	probably benign
R4207:Nlrp10	UTSW	7	108924341	missense	possibly damaging	0.56
R4786:Nlrp10	UTSW	7	108925238	missense	probably damaging	1.00
R5048:Nlrp10	UTSW	7	108924565	missense	probably benign	0.01
R5568:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R5993:Nlrp10	UTSW	7	108927013	missense	probably benign	0.00
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6170:Nlrp10	UTSW	7	108924464	missense	probably benign	0.00
R6320:Nlrp10	UTSW	7	108925746	missense	possibly damaging	0.82
R6935:Nlrp10	UTSW	7	108926900	missense	probably damaging	0.99
R7024:Nlrp10	UTSW	7	108925198	missense	possibly damaging	0.73
R7081:Nlrp10	UTSW	7	108924648	missense	probably benign	0.02
R7397:Nlrp10	UTSW	7	108924692	missense	probably damaging	1.00
R7720:Nlrp10	UTSW	7	108924488	missense	probably benign	0.36
R7763:Nlrp10	UTSW	7	108925826	missense	probably damaging	0.99
R7776:Nlrp10	UTSW	7	108925449	missense	probably damaging	1.00
R7823:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R7852:Nlrp10	UTSW	7	108925074	missense	probably damaging	1.00
R8272:Nlrp10	UTSW	7	108925896	missense	probably benign	0.00
Z1177:Nlrp10	UTSW	7	108925851	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGACTTTGTACCTTCCCG -3'
(R):5'- CTTGTGAAGGAGGACCAGAGTC -3'

Sequencing Primer
(F):5'- GACTTTGTACCTTCCCGCTACTAAAG -3'
(R):5'- CAGGGAGAGGCCACACAC -3'

Posted On

2016-06-08