Mutagenetix > Incidental Mutations

Incidental Mutation 'R5138:Lrp5'

396325

Institutional Source

Beutler Lab

Gene Symbol

Lrp5

Ensembl Gene

ENSMUSG00000024913

Gene Name

low density lipoprotein receptor-related protein 5

Synonyms

LR3, LRP7

MMRRC Submission

042724-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R5138 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3584828-3686564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3628319 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 512 (Q512L)

Ref Sequence

ENSEMBL: ENSMUSP00000135654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000176867] [ENSMUST00000177330]

Predicted Effect

probably benign
Transcript: ENSMUST00000025856
AA Change: Q512L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: Q512L

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART
EGF	603	640	2.48e-1	SMART
LY	666	708	5.92e-8	SMART
LY	709	751	5.65e-14	SMART
LY	752	795	3.81e-11	SMART
LY	796	837	3.54e-6	SMART
LY	838	877	1.33e-1	SMART
EGF	904	941	1.22e0	SMART
LY	968	1009	4.39e-2	SMART
LY	1015	1057	1.81e0	SMART
LY	1058	1102	9.47e-7	SMART
LY	1103	1145	6.91e-9	SMART
LY	1146	1186	1.53e0	SMART
EGF	1215	1253	2.85e-1	SMART
LDLa	1257	1296	1.23e-13	SMART
LDLa	1297	1333	3.26e-9	SMART
LDLa	1334	1371	1.31e-13	SMART
transmembrane domain	1384	1406	N/A	INTRINSIC
low complexity region	1494	1503	N/A	INTRINSIC
low complexity region	1571	1578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176867
AA Change: Q512L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913
AA Change: Q512L

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177330

SMART Domains

Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART

Meta Mutation Damage Score

0.0637

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	C	A	9: 46,306,821		probably null	Het
Actr10	G	A	12: 70,961,879	G362E	probably damaging	Het
Aldh1a3	T	C	7: 66,407,852	T278A	probably damaging	Het
Arpp21	T	A	9: 112,179,084	K116M	probably damaging	Het
Arrdc3	T	C	13: 80,891,065	Y72H	probably damaging	Het
Atr	T	C	9: 95,937,596	V2212A	probably benign	Het
Bcdin3d	A	G	15: 99,471,051	F89S	possibly damaging	Het
Cacna1d	C	A	14: 30,490,972	A44S	probably benign	Het
Cbx3	A	G	6: 51,475,289	E28G	probably damaging	Het
Cdh23	A	T	10: 60,312,282	F2722L	probably damaging	Het
Clec11a	A	G	7: 44,304,638	V297A	probably benign	Het
Clk2	C	A	3: 89,175,499		probably benign	Het
Clybl	T	A	14: 122,371,304	C103S	possibly damaging	Het
Col12a1	T	A	9: 79,643,966	N2123Y	probably damaging	Het
Corin	G	A	5: 72,339,059	P517L	probably damaging	Het
Ddhd2	A	T	8: 25,727,699	I717N	probably damaging	Het
Derl2	C	A	11: 71,014,564	G31*	probably null	Het
Dgcr8	A	G	16: 18,278,077	V523A	probably damaging	Het
Dnah8	T	C	17: 30,765,597	S3090P	probably damaging	Het
Dsp	C	A	13: 38,183,298	H641N	probably benign	Het
Dsp	A	T	13: 38,195,845	T1590S	possibly damaging	Het
Duox2	A	T	2: 122,297,531	L57Q	probably damaging	Het
Etfdh	A	T	3: 79,623,573	V47D	probably benign	Het
Exoc1	T	C	5: 76,568,075	Y823H	probably damaging	Het
Fam81a	C	T	9: 70,099,175	R185K	probably benign	Het
Fsip2	A	G	2: 82,981,424	I2696V	probably benign	Het
Glis1	GCACACA	GCACA	4: 107,623,105		probably null	Het
Gm15448	A	T	7: 3,824,557	Y200*	probably null	Het
Gtf3c1	A	T	7: 125,647,492	N1548K	probably benign	Het
Hist1h3b	G	A	13: 23,752,630	R84H	probably damaging	Het
Hkdc1	A	T	10: 62,398,691	I575N	probably damaging	Het
Ifi208	A	G	1: 173,690,673	I449V	probably null	Het
Ino80	T	C	2: 119,383,421	T1223A	probably damaging	Het
Kctd9	T	C	14: 67,728,748		probably null	Het
Khdrbs1	A	G	4: 129,741,854	Y103H	probably benign	Het
Kmt2e	A	G	5: 23,502,695	H1752R	probably damaging	Het
Map2k5	T	C	9: 63,263,158	T293A	probably damaging	Het
Myo7a	C	A	7: 98,083,599	R657L	probably damaging	Het
Myrfl	A	G	10: 116,796,058		probably null	Het
Nfatc2	G	A	2: 168,536,309	H258Y	probably damaging	Het
Nup205	T	A	6: 35,225,866	L1336Q	probably damaging	Het
Olfr1218	T	C	2: 89,054,947	I160V	probably benign	Het
Olfr1436	T	C	19: 12,298,776	M119V	possibly damaging	Het
Olfr419	A	G	1: 174,250,829	S33P	probably damaging	Het
Otog	T	A	7: 46,250,006	S244T	possibly damaging	Het
Pcdh17	T	G	14: 84,447,209	I372S	probably damaging	Het
Plagl1	A	G	10: 13,128,175		probably benign	Het
Pnpla7	T	C	2: 25,041,103	F910S	possibly damaging	Het
Prdm13	G	A	4: 21,679,507	P328S	unknown	Het
Prdm5	C	T	6: 65,856,102	Q152*	probably null	Het
Psat1	A	G	19: 15,914,948	F216S	possibly damaging	Het
Psg21	A	T	7: 18,656,528	M1K	probably null	Het
Rab11fip3	A	T	17: 25,991,026	S994T	probably benign	Het
Rax	A	G	18: 65,938,318		probably benign	Het
Rgs22	A	T	15: 36,099,788	S260R	probably benign	Het
Ryr2	A	T	13: 11,660,289	H3317Q	probably damaging	Het
Sc5d	A	G	9: 42,255,515	Y243H	probably damaging	Het
Serpinf1	T	C	11: 75,415,028	E178G	probably damaging	Het
Slc15a3	A	T	19: 10,856,005	Y462F	probably damaging	Het
Slc9b1	G	A	3: 135,357,773		probably benign	Het
Slit2	C	T	5: 48,281,967	P1111S	probably damaging	Het
Slit3	T	C	11: 35,588,985	Y330H	probably damaging	Het
Snw1	T	C	12: 87,460,435	K204E	probably benign	Het
Steap1	A	G	5: 5,736,486	I317T	probably damaging	Het
Sval2	A	G	6: 41,861,945	N20S	probably damaging	Het
Tfrc	C	A	16: 32,615,209	Y85*	probably null	Het
Tmem87a	T	C	2: 120,371,545	T412A	possibly damaging	Het
Utp20	T	C	10: 88,747,377	K2705E	probably damaging	Het
Vmn1r230	A	T	17: 20,846,968	K140*	probably null	Het
Vmn2r62	A	T	7: 42,764,816	H734Q	possibly damaging	Het
Zbtb8os	T	A	4: 129,346,926		probably benign	Het
Zfp608	A	T	18: 54,891,799	H1466Q	probably damaging	Het
Zfp957	C	T	14: 79,212,922	C479Y	probably damaging	Het

Other mutations in Lrp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrp5	APN	19	3649404	missense	probably benign
IGL00902:Lrp5	APN	19	3600774	missense	probably damaging	1.00
IGL02032:Lrp5	APN	19	3615886	splice site	probably benign
IGL02331:Lrp5	APN	19	3591816	missense	possibly damaging	0.64
IGL02401:Lrp5	APN	19	3593585	missense	probably damaging	1.00
IGL02471:Lrp5	APN	19	3602408	missense	probably benign	0.31
IGL02572:Lrp5	APN	19	3614283	missense	probably benign	0.17
IGL02637:Lrp5	APN	19	3630269	missense	probably benign	0.03
IGL02696:Lrp5	APN	19	3602253	missense	probably benign
IGL02742:Lrp5	APN	19	3604022	missense	probably damaging	0.99
IGL02804:Lrp5	APN	19	3600777	missense	possibly damaging	0.63
IGL03089:Lrp5	APN	19	3620314	splice site	probably null
IGL03243:Lrp5	APN	19	3630159	missense	probably benign	0.12
r18	UTSW	19		small insertion
PIT4494001:Lrp5	UTSW	19	3610091	missense	probably damaging	1.00
R0219:Lrp5	UTSW	19	3597349	missense	probably damaging	1.00
R0526:Lrp5	UTSW	19	3628295	missense	probably damaging	1.00
R0597:Lrp5	UTSW	19	3600777	missense	possibly damaging	0.63
R0883:Lrp5	UTSW	19	3605308	missense	probably damaging	1.00
R1086:Lrp5	UTSW	19	3649476	missense	probably benign	0.28
R1417:Lrp5	UTSW	19	3586425	missense	probably benign	0.04
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1533:Lrp5	UTSW	19	3614234	missense	probably benign	0.17
R1538:Lrp5	UTSW	19	3647585	missense	possibly damaging	0.70
R1856:Lrp5	UTSW	19	3597346	missense	probably benign	0.18
R1930:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1931:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1932:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1951:Lrp5	UTSW	19	3620298	missense	possibly damaging	0.89
R2016:Lrp5	UTSW	19	3610056	missense	probably benign	0.04
R2131:Lrp5	UTSW	19	3622708	missense	possibly damaging	0.87
R2153:Lrp5	UTSW	19	3614339	missense	probably benign	0.22
R2403:Lrp5	UTSW	19	3597430	missense	probably damaging	1.00
R3158:Lrp5	UTSW	19	3615849	missense	probably damaging	0.97
R3771:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3772:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3773:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3825:Lrp5	UTSW	19	3605290	nonsense	probably null
R3887:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3888:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3893:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3917:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R4279:Lrp5	UTSW	19	3591778	missense	possibly damaging	0.94
R4714:Lrp5	UTSW	19	3659454	missense	probably damaging	1.00
R4825:Lrp5	UTSW	19	3614292	missense	probably damaging	1.00
R5102:Lrp5	UTSW	19	3659304	missense	probably damaging	0.96
R5497:Lrp5	UTSW	19	3602319	missense	probably damaging	1.00
R5632:Lrp5	UTSW	19	3622512	missense	probably benign
R5887:Lrp5	UTSW	19	3604094	missense	probably benign	0.01
R5950:Lrp5	UTSW	19	3602333	missense	probably benign	0.17
R5987:Lrp5	UTSW	19	3628299	missense	probably damaging	1.00
R6080:Lrp5	UTSW	19	3628316	missense	probably benign	0.32
R6181:Lrp5	UTSW	19	3628427	missense	probably damaging	1.00
R6236:Lrp5	UTSW	19	3630483	splice site	probably null
R6332:Lrp5	UTSW	19	3659355	missense	probably damaging	1.00
R6511:Lrp5	UTSW	19	3652296	missense	probably damaging	1.00
R6641:Lrp5	UTSW	19	3652287	missense	probably damaging	1.00
R6791:Lrp5	UTSW	19	3600753	missense	probably damaging	1.00
R6865:Lrp5	UTSW	19	3620013	critical splice donor site	probably null
R6906:Lrp5	UTSW	19	3622638	missense	probably damaging	1.00
R6922:Lrp5	UTSW	19	3605301	missense	probably damaging	1.00
R7091:Lrp5	UTSW	19	3630184	missense	probably damaging	1.00
R7303:Lrp5	UTSW	19	3591774	missense	probably damaging	0.99
R7368:Lrp5	UTSW	19	3620085	missense	possibly damaging	0.95
R7381:Lrp5	UTSW	19	3593588	missense	probably benign	0.20
R7385:Lrp5	UTSW	19	3612197	critical splice donor site	probably null
R7392:Lrp5	UTSW	19	3610199	missense	probably damaging	1.00
R7448:Lrp5	UTSW	19	3649439	missense	probably benign	0.01
R7585:Lrp5	UTSW	19	3604094	missense	possibly damaging	0.88
R7662:Lrp5	UTSW	19	3686353	critical splice donor site	probably null
R8056:Lrp5	UTSW	19	3597337	missense	probably damaging	0.98
Z1177:Lrp5	UTSW	19	3628345	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGATACCCACAGCAAACATGGG -3'
(R):5'- AGGTGTGTCCCTCAGAGTTG -3'

Sequencing Primer
(F):5'- GTGAAGGGCATCCAGGC -3'
(R):5'- CTCAGAGTTGGGGCCTAGCAAG -3'

Posted On

2016-06-21